IL-16 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10944-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-16 Reagents
CRO Services
Product recommended

All IL-16 Reagents
IL-16 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human interleukin 16 (lymphocyte chemoattractant factor) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-16 cDNA ORF Clone, Human, N-Myc tag Alternative Names
LCF cDNA ORF Clone, Human;NIL16 cDNA ORF Clone, Human;prIL-16 cDNA ORF Clone, Human;PRIL16 cDNA ORF Clone, Human
IL-16 Background Information
Full Name
interleukin 16
References
  • Maciaszek JW, et al. (1997) IL-16 represses HIV-1 promoter activity. J Immunol. 158(1): 5-8.
  • Zhou P, et al. (1997) Human CD4+ cells transfected with IL-16 cDNA are resistant to HIV-1 infection: inhibition of mRNA expression. Nat Med. 3(6): 659-64.
  • Theodore AC, et al. (1996) CD4 ligand IL-16 inhibits the mixed lymphocyte reaction. J Immunol. 157(5): 1958-64.
  • IL-16 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-16 cDNA ORF Clone in Cloning Vector, Mouse MG51303-G
    IL-16 cDNA ORF Clone, Mouse, untagged MG51303-UT
    IL-16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51303-ACGLN
    IL-16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51303-ACG
    IL-16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51303-ACR
    IL-16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51303-CF
    IL-16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51303-NF
    IL-16 cDNA ORF Clone, Mouse, C-His tag MG51303-CH
    IL-16 cDNA ORF Clone, Mouse, N-His tag MG51303-NH
    IL-16 cDNA ORF Clone, Mouse, C-HA tag MG51303-CY
    IL-16 cDNA ORF Clone, Mouse, N-HA tag MG51303-NY
    IL-16 cDNA ORF Clone, Mouse, C-Myc tag MG51303-CM
    IL-16 cDNA ORF Clone, Mouse, N-Myc tag MG51303-NM
    IL-16 qPCR Primer Pairs, Mouse MP201181

    IL-16 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-16 cDNA ORF Clone in Cloning Vector, Human HG10944-G
    IL-16 cDNA ORF Clone, Human, untagged HG10944-UT
    IL-16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10944-ACGLN
    IL-16 cDNA ORF Clone, Human, C-GFPSpark® tag HG10944-ACG
    IL-16 cDNA ORF Clone, Human, C-OFPSpark® tag HG10944-ACR
    IL-16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10944-CF
    IL-16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10944-NF
    IL-16 cDNA ORF Clone, Human, C-His tag HG10944-CH
    IL-16 cDNA ORF Clone, Human, N-His tag HG10944-NH
    IL-16 cDNA ORF Clone, Human, C-HA tag HG10944-CY
    IL-16 cDNA ORF Clone, Human, N-HA tag HG10944-NY
    IL-16 cDNA ORF Clone, Human, C-Myc tag HG10944-CM
    IL-16 qPCR Primer Pairs, Human HP100934
    info info
    添加购物车成功! 添加购物车失败!