Text Size:AAA

Human IL16 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL16 cDNA Clone Product Information
NCBI RefSeq:NM_004513.5
RefSeq ORF Size:1896bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 16 (lymphocyte chemoattractant factor) with C terminal His tag.
Gene Synonym:LCF, IL-16, prIL-16, FLJ16806, FLJ42735, FLJ44234, HsT19289
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL16 qPCR primers for gene expression analysis, HP100934 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Maciaszek JW, et al. (1997) IL-16 represses HIV-1 promoter activity. J Immunol. 158(1): 5-8.
  • Zhou P, et al. (1997) Human CD4+ cells transfected with IL-16 cDNA are resistant to HIV-1 infection: inhibition of mRNA expression. Nat Med. 3(6): 659-64.
  • Theodore AC, et al. (1996) CD4 ligand IL-16 inhibits the mixed lymphocyte reaction. J Immunol. 157(5): 1958-64.
  • Size / Price
    Catalog: HG10944-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"