Text Size:AAA

Human IL13RA1/IL-13RA1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human IL13RA1 cDNA Clone Product Information
    NCBI RefSeq:NM_001560.2
    RefSeq ORF Size:1284bp
    cDNA Description:Full length Clone DNA of Human interleukin 13 receptor, alpha 1.
    Gene Synonym:NR4, CD213A1, IL-13Ra, IL13RA1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    BGH( 5' TAGAAGGCACAGTCGAGG 3' )
    ( We provide with IL13Ra1 qPCR primers for gene expression analysis, HP100821 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Interleukin 13 receptor, alpha 1, also known as IL13RA1/IL-13RA1 and CD213A1 (cluster of differentiation 213A1), is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. IL13RA1/IL-13RA1 serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. IL13RA1/IL-13RA1 binds with low affinity to interleukin-13 (IL13). This subunit together with IL4RA can form a functional receptor for IL13. IL13RA1/IL-13RA1 also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity.

    References
  • Kawakami M, et al. (2002) Mutation and functional analysis of IL-13 receptors in human malignant glioma cells. Oncol Res. 12 (11-12): 459-67.
  • Umeshita-Suyama R, et al. (2000) Characterization of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of requirement of tyrosine residue for STAT3 activation. Int Immunol. 12 (11): 1499-509.
  • He JQ, et al. (2003) Polymorphisms in the IL13, IL13RA1, and IL4RA genes and rate of decline in lung function in smokers. Am J Respir. Cell Mol Biol. 28 (3): 379-85.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"