After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL13RA1/IL-13RA1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human IL13RA1 cDNA Clone Product Information
NCBI RefSeq:NM_001560.2
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 13 receptor, alpha 1 with N terminal Myc tag.
Gene Synonym:NR4, CD213A1, IL-13Ra, IL13RA1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin 13 receptor, alpha 1, also known as IL13RA1/IL-13RA1 and CD213A1 (cluster of differentiation 213A1), is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. IL13RA1/IL-13RA1 serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. IL13RA1/IL-13RA1 binds with low affinity to interleukin-13 (IL13). This subunit together with IL4RA can form a functional receptor for IL13. IL13RA1/IL-13RA1 also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity.

References
  • Kawakami M, et al. (2002) Mutation and functional analysis of IL-13 receptors in human malignant glioma cells. Oncol Res. 12 (11-12): 459-67.
  • Umeshita-Suyama R, et al. (2000) Characterization of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of requirement of tyrosine residue for STAT3 activation. Int Immunol. 12 (11): 1499-509.
  • He JQ, et al. (2003) Polymorphisms in the IL13, IL13RA1, and IL4RA genes and rate of decline in lung function in smokers. Am J Respir. Cell Mol Biol. 28 (3): 379-85.
  • Size / Price
    Catalog: HG10943-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"