After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IL12RB2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human IL12RB2 cDNA Clone Product Information
NCBI RefSeq:NM_001559.2
RefSeq ORF Size:2589bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 12 receptor, beta 2 with HA tag.
Gene Synonym:IL12RB2, RP11-102M16.1
Species:Human
Vector:pCMV2-HA
Plasmid:pCMV2-IL12RB2-HA
Restriction Site:KpnI + XhoI (5.4kb + 2.64kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 714T/C point mutation encoding the original amino acid.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL12RB2 Gene Plasmid Map
Human IL12Rb2 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
 
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.

References
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • Size / Price
    Catalog: HG10145-M-Y
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human IL12Rb2 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"