Quick Order

Human IL-11 / interleukin 11 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human IL11 cDNA Clone Product Information
NCBI RefSeq:BC012506
RefSeq ORF Size:600bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 11 with N terminal HA tag.
Gene Synonym:AGIF, IL-11, IL11
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

References
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • Size / Price
    Catalog: HG12225-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability4-5 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"