IL10RA cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10419-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL10RA Reagents
CRO Services
Product recommended

All IL10RA Reagents
IL10RA cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1776 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human interleukin 10 receptor, alpha (IL10RA) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + NotI(6kb+1.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL10RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL10RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Cynomolgus CDCP1 Gene Plasmid Map 5627
Human CD210 / IL10RA Gene Expression validated Image 16665
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
IL10RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD210 cDNA ORF Clone, Human;CD210a cDNA ORF Clone, Human;CDW210A cDNA ORF Clone, Human;HIL-10R cDNA ORF Clone, Human;IL-10R1 cDNA ORF Clone, Human;IL10R cDNA ORF Clone, Human
IL10RA Background Information

CD210, also known as IL10RA, is a receptor for interleukin 10. CD210 has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD210 promotes survival of progenitor myeloid cells. Activation of CD210 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.

Full Name
interleukin 10 receptor, alpha
References
  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
  • IL10RA cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL10RA cDNA ORF Clone in Cloning Vector, Rhesus CG90125-G
    IL10RA cDNA ORF Clone, Rhesus, untagged CG90125-UT
    IL10RA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90125-ACG
    IL10RA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90125-ACGLN
    IL10RA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90125-ACR
    IL10RA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90125-CF
    IL10RA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90125-NF
    IL10RA cDNA ORF Clone, Rhesus, C-His tag CG90125-CH
    IL10RA cDNA ORF Clone, Rhesus, N-His tag CG90125-NH
    IL10RA cDNA ORF Clone, Rhesus, C-HA tag CG90125-CY
    IL10RA cDNA ORF Clone, Rhesus, N-HA tag CG90125-NY
    IL10RA cDNA ORF Clone, Rhesus, C-Myc tag CG90125-CM
    IL10RA cDNA ORF Clone, Rhesus, N-Myc tag CG90125-NM

    IL10RA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL10RA cDNA ORF Clone in Cloning Vector, Rat RG80183-G
    IL10RA cDNA ORF Clone, Rat, untagged RG80183-UT
    IL10RA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80183-ACGLN
    IL10RA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80183-ACG
    IL10RA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80183-ACR
    IL10RA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80183-CF
    IL10RA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80183-NF
    IL10RA cDNA ORF Clone, Rat, C-His tag RG80183-CH
    IL10RA cDNA ORF Clone, Rat, N-His tag RG80183-NH
    IL10RA cDNA ORF Clone, Rat, C-HA tag RG80183-CY
    IL10RA cDNA ORF Clone, Rat, N-HA tag RG80183-NY
    IL10RA cDNA ORF Clone, Rat, C-Myc tag RG80183-CM
    IL10RA cDNA ORF Clone, Rat, N-Myc tag RG80183-NM
    IL10RA qPCR Primer Pairs, Rat RP300175

    IL10RA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL10RA cDNA ORF Clone in Cloning Vector, Mouse MG51298-G
    IL10RA cDNA ORF Clone, Mouse, untagged MG51298-UT
    IL10RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51298-ACGLN
    IL10RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51298-ACG
    IL10RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51298-ACR
    IL10RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51298-CF
    IL10RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51298-NF
    IL10RA cDNA ORF Clone, Mouse, C-His tag MG51298-CH
    IL10RA cDNA ORF Clone, Mouse, N-His tag MG51298-NH
    IL10RA cDNA ORF Clone, Mouse, C-HA tag MG51298-CY
    IL10RA cDNA ORF Clone, Mouse, N-HA tag MG51298-NY
    IL10RA cDNA ORF Clone, Mouse, C-Myc tag MG51298-CM
    IL10RA cDNA ORF Clone, Mouse, N-Myc tag MG51298-NM
    IL10RA qPCR Primer Pairs, Mouse MP201177

    IL10RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL10RA cDNA ORF Clone in Cloning Vector, Human HG10419-M
    IL10RA cDNA ORF Clone, Human, untagged HG10419-UT
    IL10RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10419-ACGLN
    IL10RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10419-ACG
    IL10RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10419-ACR
    IL10RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10419-NF
    IL10RA cDNA ORF Clone, Human, C-His tag HG10419-CH
    IL10RA cDNA ORF Clone, Human, N-His tag HG10419-NH
    IL10RA cDNA ORF Clone, Human, C-HA tag HG10419-CY
    IL10RA cDNA ORF Clone, Human, N-HA tag HG10419-NY
    IL10RA cDNA ORF Clone, Human, C-Myc tag HG10419-CM
    IL10RA cDNA ORF Clone, Human, N-Myc tag HG10419-NM
    IL10RA qPCR Primer Pairs, Human HP100449
    info info
    添加购物车成功! 添加购物车失败!