IkB alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12045-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IkB alpha Reagents
CRO Services
Product recommended

All IkB alpha Reagents
IkB alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
954 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 81 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IkB alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IkB alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human IkB alpha/NFKBIA Gene Expression validated Image 1874
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
IkB alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
IKBA cDNA ORF Clone, Human;MAD-3 cDNA ORF Clone, Human;NFKBI cDNA ORF Clone, Human
IkB alpha Background Information

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

Full Name
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Research Areas
References
  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • IkB alpha cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IkB alpha cDNA ORF Clone in Cloning Vector, Rat RG82336-U
    IkB alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82336-ACGLN

    IkB alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IkB alpha cDNA ORF Clone in Cloning Vector, Mouse MG53295-U
    IkB alpha cDNA ORF Clone, Mouse, untagged MG53295-UT
    IkB alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53295-ACGLN
    IkB alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53295-ACG
    IkB alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53295-ANG
    IkB alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53295-ACR
    IkB alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53295-ANR
    IkB alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53295-CF
    IkB alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53295-NF
    IkB alpha cDNA ORF Clone, Mouse, C-His tag MG53295-CH
    IkB alpha cDNA ORF Clone, Mouse, N-His tag MG53295-NH
    IkB alpha cDNA ORF Clone, Mouse, C-HA tag MG53295-CY
    IkB alpha cDNA ORF Clone, Mouse, N-HA tag MG53295-NY
    IkB alpha cDNA ORF Clone, Mouse, C-Myc tag MG53295-CM
    IkB alpha cDNA ORF Clone, Mouse, N-Myc tag MG53295-NM

    IkB alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IkB alpha cDNA ORF Clone in Cloning Vector, Human HG12045-G
    IkB alpha cDNA ORF Clone, Human, untagged HG12045-UT
    IkB alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG12045-ACG
    IkB alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12045-ACGLN
    IkB alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG12045-ANG
    IkB alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG12045-ACR
    IkB alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG12045-ANR
    IkB alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12045-NF
    IkB alpha cDNA ORF Clone, Human, C-His tag HG12045-CH
    IkB alpha cDNA ORF Clone, Human, N-His tag HG12045-NH
    IkB alpha cDNA ORF Clone, Human, C-HA tag HG12045-CY
    IkB alpha cDNA ORF Clone, Human, N-HA tag HG12045-NY
    IkB alpha cDNA ORF Clone, Human, C-Myc tag HG12045-CM
    IkB alpha cDNA ORF Clone, Human, N-Myc tag HG12045-NM
    IkB alpha qPCR Primer Pairs, Human HP101579
    info info
    添加购物车成功! 添加购物车失败!