IGSF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11290-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGSF3 Reagents
CRO Services
Product recommended

All IGSF3 Reagents
IGSF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3645 bp
Description
Full length Clone DNA of Human immunoglobulin superfamily, member 3, transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGSF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
EWI-3 cDNA ORF Clone, Human;LCDD cDNA ORF Clone, Human;V8 cDNA ORF Clone, Human
IGSF3 Background Information

Immunoglobulin superfamily member 3 (IGSF3), also known as Glu-Trp-Ile EWI motif-containing protein 3, IgSF3 and EWI-3 and IGSF3, is a single-pass type I membrane protein which belongs to the EWI subfamily of the Ig Superfamily of molecules. IGSF3 has an overall structural similarity and strong sequence similarity to V7, a human leukocyte surface protein. IGSF3 contains eight Ig-like C2-type (immunoglobulin-like) domains. IGSF3 is expressed in a wide range of tissues with high expression in Placenta, kidney and lung. EWI-2 is part of a novel Ig subfamily that includes EWI-F (F2alpha receptor regulatory protein (FPRP), CD9P-1 ), EWI-3 (IGSF3), and EWI-101 (CD101). All four members of this Ig subfamily contain a Glu-Trp-Ile (EWI) motif not seen in other Ig proteins. Human IGSF3 shares 92 % aa identity with mouse IGSF3.

Full Name
immunoglobulin superfamily, member 3
References
  • Saupe S, et al. (1998) Molecular cloning of a human cDNA IGSF3 encoding an immunoglobulin-like membrane protein: expression and mapping to chromosome band 1p13. Genomics. 52(3): 305-11.
  • Lazaar AL, et al. (2001) VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. J Immunol. 166(1): 155-61.
  • Wetzel A, et al. (2004) Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). J Immunol. 172(6): 3850-9.
  • info info
    添加购物车成功! 添加购物车失败!