After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IGSF10 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human IGSF10 cDNA Clone Product Information
NCBI RefSeq:BC031063
RefSeq ORF Size:1809bp
cDNA Description:Full length Clone DNA of Homo sapiens immunoglobulin superfamily, member 10 DNA.
Gene Synonym:CMF608
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
????��??????3?o?MG53720???������?o��?????o?????????��?����??���䡧?2??????�㨨���?1????������?��????????��????����騨���???
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"