Lambda 5 cDNA ORF Clone, Human, C-His tag

Cat: HG13461-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Lambda 5 Reagents
CRO Services
Product recommended

All Lambda 5 Reagents
Lambda 5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Human immunoglobulin lambda-like polypeptide 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lambda 5 cDNA ORF Clone, Human, C-His tag Alternative Names
14.1 cDNA ORF Clone, Human;AGM2 cDNA ORF Clone, Human;CD179b cDNA ORF Clone, Human;IGL1 cDNA ORF Clone, Human;IGL5 cDNA ORF Clone, Human;IGLJ14.1 cDNA ORF Clone, Human;IGLL cDNA ORF Clone, Human;IGO cDNA ORF Clone, Human;IGVPB cDNA ORF Clone, Human;VPREB2 cDNA ORF Clone, Human
Lambda 5 Background Information
Full Name
immunoglobulin lambda-like polypeptide 1

Lambda 5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Lambda 5 cDNA ORF Clone in Cloning Vector, Mouse MG50841-G
Lambda 5 cDNA ORF Clone, Mouse, untagged MG50841-UT
Lambda 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50841-ACGLN
Lambda 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50841-ACG
Lambda 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50841-ACR
Lambda 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50841-CF
Lambda 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50841-NF
Lambda 5 cDNA ORF Clone, Mouse, C-His tag MG50841-CH
Lambda 5 cDNA ORF Clone, Mouse, N-His tag MG50841-NH
Lambda 5 cDNA ORF Clone, Mouse, C-HA tag MG50841-CY
Lambda 5 cDNA ORF Clone, Mouse, N-HA tag MG50841-NY
Lambda 5 cDNA ORF Clone, Mouse, C-Myc tag MG50841-CM
Lambda 5 cDNA ORF Clone, Mouse, N-Myc tag MG50841-NM
Lambda 5 qPCR Primer Pairs, Mouse MP200812

Lambda 5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Lambda 5 cDNA ORF Clone in Cloning Vector, Human HG13461-G
Lambda 5 cDNA ORF Clone, Human, untagged HG13461-UT
Lambda 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13461-ACG
Lambda 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13461-ACGLN
Lambda 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13461-ACR
Lambda 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13461-CF
Lambda 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13461-NF
Lambda 5 cDNA ORF Clone, Human, N-His tag HG13461-NH
Lambda 5 cDNA ORF Clone, Human, C-HA tag HG13461-CY
Lambda 5 cDNA ORF Clone, Human, N-HA tag HG13461-NY
Lambda 5 cDNA ORF Clone, Human, C-Myc tag HG13461-CM
Lambda 5 cDNA ORF Clone, Human, N-Myc tag HG13461-NM
Lambda 5 qPCR Primer Pairs, Human HP102161
info info
添加购物车成功! 添加购物车失败!