IGIP/C5orf53 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13634-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGIP/C5orf53 Reagents
CRO Services
Product recommended

All IGIP/C5orf53 Reagents
IGIP/C5orf53 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
162 bp
Description
Full length Clone DNA of Human IgA-inducing protein homolog (Bos taurus) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGIP/C5orf53 cDNA ORF Clone, Human, C-Myc tag Alternative Names
C5orf53 cDNA ORF Clone, Human
IGIP/C5orf53 Background Information
Full Name
IgA-inducing protein

IGIP/C5orf53 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IGIP/C5orf53 cDNA ORF Clone in Cloning Vector, Mouse MG52228-U
IGIP/C5orf53 cDNA ORF Clone, Mouse, untagged MG52228-UT
IGIP/C5orf53 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52228-ACGLN
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52228-ACG
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52228-ACR
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52228-CF
IGIP/C5orf53 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52228-NF
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-His tag MG52228-CH
IGIP/C5orf53 cDNA ORF Clone, Mouse, N-His tag MG52228-NH
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-HA tag MG52228-CY
IGIP/C5orf53 cDNA ORF Clone, Mouse, N-HA tag MG52228-NY
IGIP/C5orf53 cDNA ORF Clone, Mouse, C-Myc tag MG52228-CM
IGIP/C5orf53 cDNA ORF Clone, Mouse, N-Myc tag MG52228-NM
IGIP/C5orf53 qPCR Primer Pairs, Mouse MP202101

IGIP/C5orf53 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IGIP/C5orf53 cDNA ORF Clone in Cloning Vector, Human HG13634-G
IGIP/C5orf53 cDNA ORF Clone, Human, untagged HG13634-UT
IGIP/C5orf53 cDNA ORF Clone, Human, C-GFPSpark® tag HG13634-ACG
IGIP/C5orf53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13634-ACGLN
IGIP/C5orf53 cDNA ORF Clone, Human, C-OFPSpark® tag HG13634-ACR
IGIP/C5orf53 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13634-CF
IGIP/C5orf53 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13634-NF
IGIP/C5orf53 cDNA ORF Clone, Human, C-His tag HG13634-CH
IGIP/C5orf53 cDNA ORF Clone, Human, N-His tag HG13634-NH
IGIP/C5orf53 cDNA ORF Clone, Human, C-HA tag HG13634-CY
IGIP/C5orf53 cDNA ORF Clone, Human, N-HA tag HG13634-NY
IGIP/C5orf53 cDNA ORF Clone, Human, N-Myc tag HG13634-NM
IGIP/C5orf53 qPCR Primer Pairs, Human HP102318
info info
添加购物车成功! 添加购物车失败!