Quick Order

Human IGF-2/IGF-II Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human IGF2 cDNA Clone Product Information
NCBI RefSeq:NM_000612.4
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 (somatomedin A) with N terminal His tag.
Gene Synonym:PP1446, C11orf43, FLJ22066, FLJ44734, IGF-II, PP9974
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Insulin-like growth factor 2 (IGF-2/IGF-II) is a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. IGF-2/IGF-II is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. IGF-2 and exhibited statistically significant, positive associations with colorectal cancer risk when cases were confined to those diagnosed within a relatively short time period after enrolment. Circulating IGF-2 and IGFBP-3 can serve as early indicators of impending colorectal cancer. IGF-2/IGF-II appears to be involved in the progression of many tumours. It binds to at least two different types of receptor: IGF type 1 (IGF 1R) and mannose 6-phosphate/IGF type 2 (M6-P/IGF 2R). Ligand binding to IGF 1R provokes mitogenic and anti-apoptotic effects. M6-P/IGF 2R has a tumour suppressor function—it mediates IGF 2 degradation. Mutation of M6-P/IGF 2R causes both diminished growth suppression and augmented growth stimulation. The aim of this study was to investigate the role of IGF 2 and its receptors (IGF 1R and IGF 2R) in human gastric cancer.

References
  • Harvey MB, et al. (1991) IGF-2 receptors are first expressed at the 2-cell stage of mouse development. Development. 111(4): 1057-60.
  • Peters G, et al. (2003) IGF-1R, IGF-1 and IGF-2 expression as potential prognostic and predictive markers in colorectal-cancer. Virchows Arch. 443(2): 139-45.
  • Burrow S, et al. (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol. 69(1): 21-7.
  • Size / Price
    Catalog: HG13032-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"