IGFBP-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10430-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IGFBP-3 Reagents
CRO Services
Product recommended

All IGFBP-3 Reagents
IGFBP-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Human insulin-like growth factor binding protein 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BP-53 cDNA ORF Clone, Human;IBP3 cDNA ORF Clone, Human;IGFBP3 cDNA ORF Clone, Human
IGFBP-3 Background Information

The Insulin-like Growth Factor (IGF) signaling system plays a central role in cellular growth, differentiation and proliferation. IGFBP3 is the most abundant IGF binding protein in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms. It appears to function both by cell cycle blockade and the induction of apoptosis. IGFBP3 can be transported to the nucleus by an importin beta mediated mechanism, where it has been shown to interact with the retinoid X receptor alpha and possibly other nuclear elements. IGFBP3 antiproliferative signalling appears to require an active transforming growth factor beta (TGF-beta) signalling pathway, and IGFBP3 stimulates phosphorylation of the TGF-beta signalling intermediates Smad2 and Smad3. IGFBP3 has IGF-independent roles in inhibiting cell proliferation in cancer cell lines. Nuclear transcription factor, retinoid X receptor (RXR)-alpha, and IGFBP3 functionally interact to reduce prostate tumor growth and prostate-specific antigen in vivo. Several clinical studies have proposed that individuals with IGFBP3 levels in the upper range of normal may have a decreased risk for certain common cancers. This includes evidence of a protective effect against breast cancer, prostate cancer, colorectal cancer, and lung cancer. Moreover, IGFBP3 inhibits insulin-stimulated glucose uptake into adipocytes independent of IGF.

Full Name
insulin-like growth factor binding protein 3
References
  • Baxter RC. (2001) Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol. 54(3): 145-8.
  • Butt AJ, et al. (2001) IGFBP-3 and apoptosis--a license to kill? Apoptosis. 6(3): 199-205.
  • Ali O, et al. (2003) Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35(11-12): 726-33.
  • Yamada PM, et al. (2009) Perspectives in mammalian IGFBP-3 biology: local vs. systemic action. Am J Physiol Cell Physiol. 296(5): C954-76.
  • IGFBP-3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IGFBP-3 cDNA ORF Clone in Cloning Vector, Rhesus CG90084-G
    IGFBP-3 cDNA ORF Clone, Rhesus, untagged CG90084-UT
    IGFBP-3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90084-ACG
    IGFBP-3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90084-ACGLN
    IGFBP-3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90084-ACR
    IGFBP-3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90084-CF
    IGFBP-3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90084-NF
    IGFBP-3 cDNA ORF Clone, Rhesus, C-His tag CG90084-CH
    IGFBP-3 cDNA ORF Clone, Rhesus, N-His tag CG90084-NH
    IGFBP-3 cDNA ORF Clone, Rhesus, C-HA tag CG90084-CY
    IGFBP-3 cDNA ORF Clone, Rhesus, N-HA tag CG90084-NY
    IGFBP-3 cDNA ORF Clone, Rhesus, C-Myc tag CG90084-CM
    IGFBP-3 cDNA ORF Clone, Rhesus, N-Myc tag CG90084-NM

    IGFBP-3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGFBP-3 cDNA ORF Clone in Cloning Vector, Human HG10430-M
    IGFBP-3 cDNA ORF Clone, Human, untagged HG10430-UT
    IGFBP-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10430-ACGLN
    IGFBP-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10430-ACG
    IGFBP-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10430-ACR
    IGFBP-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10430-NF
    IGFBP-3 cDNA ORF Clone, Human, C-His tag HG10430-CH
    IGFBP-3 cDNA ORF Clone, Human, N-His tag HG10430-NH
    IGFBP-3 cDNA ORF Clone, Human, C-HA tag HG10430-CY
    IGFBP-3 cDNA ORF Clone, Human, N-HA tag HG10430-NY
    IGFBP-3 cDNA ORF Clone, Human, C-Myc tag HG10430-CM
    IGFBP-3 cDNA ORF Clone, Human, N-Myc tag HG10430-NM
    IGFBP-3 qPCR Primer Pairs, Human HP100460
    info info
    添加购物车成功! 添加购物车失败!