IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, untagged

Cat: HG16297-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFT20/intraflagellar transport 20 Reagents
CRO Services
Product recommended

All IFT20/intraflagellar transport 20 Reagents
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Human intraflagellar transport 20 homolog (Chlamydomonas).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFT20/intraflagellar transport 20 Background Information
Full Name
intraflagellar transport 20

IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IFT20/intraflagellar transport 20 cDNA ORF Clone in Cloning Vector, Mouse MG5A0092-U
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, untagged MG5A0092-UT
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0092-ACG
IFT20/intraflagellar transport 20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0092-ACGLN
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0092-ANG
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0092-ACR
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0092-ANR
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0092-CF
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0092-NF
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-His tag MG5A0092-CH
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-His tag MG5A0092-NH
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-HA tag MG5A0092-CY
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-HA tag MG5A0092-NY
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, C-Myc tag MG5A0092-CM
IFT20/intraflagellar transport 20 cDNA ORF Clone, Mouse, N-Myc tag MG5A0092-NM

IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IFT20/intraflagellar transport 20 cDNA ORF Clone in Cloning Vector, Human HG16297-G
IFT20/intraflagellar transport 20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16297-ACGLN
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-GFPSpark® tag HG16297-ACG
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-OFPSpark® tag HG16297-ACR
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16297-CF
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16297-NF
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-His tag HG16297-CH
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, N-His tag HG16297-NH
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-HA tag HG16297-CY
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, N-HA tag HG16297-NY
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, C-Myc tag HG16297-CM
IFT20/intraflagellar transport 20 cDNA ORF Clone, Human, N-Myc tag HG16297-NM
IFT20/intraflagellar transport 20 qPCR Primer Pairs, Human HP105051
info info
添加购物车成功! 添加购物车失败!