Text Size:AAA

Human IFNA10 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human IFNA10 cDNA Clone Product Information
    NCBI RefSeq:NM_002171.1
    RefSeq ORF Size:570bp
    cDNA Description:Full length Clone DNA of Homo sapiens interferon, alpha 10 with C terminal HA tag.
    Gene Synonym:MGC119878, MGC119879
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IFNA10 qPCR primers for gene expression analysis, HP100386 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Interferon alpha-10 (IFNA10) is a member of the interferon family. Interferons belong to the group of the regulatory glycoproteins, of low molecular mass. They are the products of infected cell-genome, but not virus, as a consequence of the cause answer by different inductors. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs have other functions: they activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they increase the ability of uninfected host cells to resist new infection by virus. Certain host symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Human IFN are divided on the sequence of amino-acids into three groups: Alpha, Beta and Gamma interferons.

    References
  • De Veer MJ, et al. (2001) Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol. 69 (6): 912-20.
  • Liu YJ. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 23: 275-306.
  • Fensterl V, et al. (2009) Interferons and viral infections. Biofactors. 35 (1): 14-20.
  •  

    IFNA10 related areas, pathways, and other information

    Size / Price
    Catalog: HG10349-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"