After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IFI30 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human IFI30 cDNA Clone Product Information
NCBI RefSeq:NM_006332.4
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Homo sapiens interferon, gamma-inducible protein 30 with C terminal His tag.
Gene Synonym:GILT, IP30, IFI-30
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.

References
  • Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.
  • Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.
  • Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.
  • Size / Price
    Catalog: HG16347-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"