IER3/IEX-1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16174-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IER3/IEX-1 Reagents
CRO Services
Product recommended

All IER3/IEX-1 Reagents
IER3/IEX-1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
471 bp
Description
Full length Clone DNA of Human immediate early response 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IER3/IEX-1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
DIF-2 cDNA ORF Clone, Human;DIF2 cDNA ORF Clone, Human;GLY96 cDNA ORF Clone, Human;IEX-1 cDNA ORF Clone, Human;IEX-1L cDNA ORF Clone, Human;IEX1 cDNA ORF Clone, Human;PRG1 cDNA ORF Clone, Human
IER3/IEX-1 Background Information
Full Name
immediate early response 3

IER3/IEX-1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IER3/IEX-1 cDNA ORF Clone in Cloning Vector, Rat RG81462-G

IER3/IEX-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IER3/IEX-1 cDNA ORF Clone in Cloning Vector, Mouse MG59446-U
IER3/IEX-1 cDNA ORF Clone, Mouse, untagged MG59446-UT
IER3/IEX-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59446-ACGLN
IER3/IEX-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59446-ACG
IER3/IEX-1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59446-ANG
IER3/IEX-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59446-ACR
IER3/IEX-1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59446-ANR
IER3/IEX-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59446-CF
IER3/IEX-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59446-NF
IER3/IEX-1 cDNA ORF Clone, Mouse, C-His tag MG59446-CH
IER3/IEX-1 cDNA ORF Clone, Mouse, N-His tag MG59446-NH
IER3/IEX-1 cDNA ORF Clone, Mouse, C-HA tag MG59446-CY
IER3/IEX-1 cDNA ORF Clone, Mouse, N-HA tag MG59446-NY
IER3/IEX-1 cDNA ORF Clone, Mouse, C-Myc tag MG59446-CM
IER3/IEX-1 cDNA ORF Clone, Mouse, N-Myc tag MG59446-NM

IER3/IEX-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IER3/IEX-1 cDNA ORF Clone in Cloning Vector, Human HG16174-G
IER3/IEX-1 cDNA ORF Clone, Human, untagged HG16174-UT
IER3/IEX-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16174-ACG
IER3/IEX-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16174-ACGLN
IER3/IEX-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16174-ACR
IER3/IEX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16174-CF
IER3/IEX-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16174-NF
IER3/IEX-1 cDNA ORF Clone, Human, C-His tag HG16174-CH
IER3/IEX-1 cDNA ORF Clone, Human, N-His tag HG16174-NH
IER3/IEX-1 cDNA ORF Clone, Human, C-HA tag HG16174-CY
IER3/IEX-1 cDNA ORF Clone, Human, N-HA tag HG16174-NY
IER3/IEX-1 cDNA ORF Clone, Human, C-Myc tag HG16174-CM
IER3/IEX-1 qPCR Primer Pairs, Human HP104943
info info
添加购物车成功! 添加购物车失败!