IDO2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13614-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IDO2 Reagents
CRO Services
Product recommended

All IDO2 Reagents
IDO2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
RefSeq ORF Size
1224 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system. The translated amino acid sequence is identical with NP_919270.2.
Description
Full length Clone DNA of Human indoleamine 2,3-dioxygenase 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.27kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IDO2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDO2 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
IDO2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
INDOL1 cDNA ORF Clone, Human
IDO2 Background Information

IDO2 belongs to the indoleamine 2,3-dioxygenase family. Indoleamine 2,3-dioxgyenase (IDO), is a cytosolic haem protein which, together with the hepatic enzyme tryptophan 2,3-dioxygenase, catalyzes the conversion of tryptophan and other indole derivatives to kynurenines. In addition to classic IDO (IDO1), a new variant, IDO2, has recently been described. IDO2 is expressed in liver, small intestine, spleen, placenta, thymus, lung, brain, kidney, and colon. IDO is widely distributed in human tissues, its physiological role is not fully understood but is of great interest. IDO can be up-regulated via cytokines such as interferon-gamma, and can thereby modulate the levels of tryptophan, which is vital for cell growth. In humans and mice, the IDO1 and IDO2 genes are present tandemly in a tail-to-head arrangment on chromosome 8. In lower vertebrates such as zebrafish and toads only a single IDO gene may be present that may be more IDO2-like in structure. This closer relationship to IDO2 suggests that IDO2 may actually be the ancestor of the better characterized IDO1 gene, and that IDO1 might have been generated by gene duplication of IDO2 before the origin of tetrapods in mammalian evolutionary history. IDO2 catalyzes the first and rate-limiting step in the kynurenine pathway of tryptophan catabolism.

Full Name
indoleamine 2,3-dioxygenase 2
References
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • Sorensen RB, et al. (2011) Spontaneous cytotoxic T-Cell reactivity against indoleamine 2,3-dioxygenase-2. Cancer Res. 71 (6): 2038-44.
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • IDO2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IDO2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1527-G
    IDO2 cDNA ORF Clone, Mouse, untagged MG5A1527-UT
    IDO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1527-ACGLN
    IDO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1527-ACG
    IDO2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1527-ANG
    IDO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1527-ACR
    IDO2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1527-ANR
    IDO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1527-CF
    IDO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1527-NF
    IDO2 cDNA ORF Clone, Mouse, C-His tag MG5A1527-CH
    IDO2 cDNA ORF Clone, Mouse, N-His tag MG5A1527-NH
    IDO2 cDNA ORF Clone, Mouse, C-HA tag MG5A1527-CY
    IDO2 cDNA ORF Clone, Mouse, N-HA tag MG5A1527-NY
    IDO2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1527-CM
    IDO2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1527-NM

    IDO2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IDO2 cDNA ORF Clone in Cloning Vector, Human HG13614-G
    IDO2 cDNA ORF Clone, Human, untagged HG13614-UT
    IDO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13614-ACGLN
    IDO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13614-ACG
    IDO2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13614-ANG
    IDO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13614-ACR
    IDO2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13614-ANR
    IDO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13614-CF
    IDO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13614-NF
    IDO2 cDNA ORF Clone, Human, C-His tag HG13614-CH
    IDO2 cDNA ORF Clone, Human, N-His tag HG13614-NH
    IDO2 cDNA ORF Clone, Human, C-HA tag HG13614-CY
    IDO2 cDNA ORF Clone, Human, N-HA tag HG13614-NY
    IDO2 cDNA ORF Clone, Human, N-Myc tag HG13614-NM
    IDO2 qPCR Primer Pairs, Human HP102299
    info info
    添加购物车成功! 添加购物车失败!