IDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14526-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IDH2 Reagents
CRO Services
Product recommended

All IDH2 Reagents
IDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human isocitrate dehydrogenase 2 (NADP+), mitochondrial with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.4kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IDH2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
IDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
D2HGA2 cDNA ORF Clone, Human;ICD-M cDNA ORF Clone, Human;IDH cDNA ORF Clone, Human;IDHM cDNA ORF Clone, Human;IDP cDNA ORF Clone, Human;IDPM cDNA ORF Clone, Human;mNADP-IDH cDNA ORF Clone, Human
IDH2 Background Information
Full Name
isocitrate dehydrogenase 2 (NADP+), mitochondrial

IDH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IDH2 cDNA ORF Clone in Cloning Vector, Rat RG81532-G

IDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IDH2 cDNA ORF Clone in Cloning Vector, Mouse MG53257-U
IDH2 cDNA ORF Clone, Mouse, untagged MG53257-UT
IDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53257-ACG
IDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53257-ACGLN
IDH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53257-ANG
IDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53257-ACR
IDH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53257-ANR
IDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53257-CF
IDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53257-NF
IDH2 cDNA ORF Clone, Mouse, C-His tag MG53257-CH
IDH2 cDNA ORF Clone, Mouse, N-His tag MG53257-NH
IDH2 cDNA ORF Clone, Mouse, C-HA tag MG53257-CY
IDH2 cDNA ORF Clone, Mouse, N-HA tag MG53257-NY
IDH2 cDNA ORF Clone, Mouse, C-Myc tag MG53257-CM
IDH2 cDNA ORF Clone, Mouse, N-Myc tag MG53257-NM

IDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IDH2 cDNA ORF Clone in Cloning Vector, Human HG14526-G
IDH2 cDNA ORF Clone, Human, untagged HG14526-UT
IDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14526-ACGLN
IDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14526-ACG
IDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14526-ANG
IDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14526-ACR
IDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14526-ANR
IDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14526-NF
IDH2 cDNA ORF Clone, Human, C-His tag HG14526-CH
IDH2 cDNA ORF Clone, Human, N-His tag HG14526-NH
IDH2 cDNA ORF Clone, Human, C-HA tag HG14526-CY
IDH2 cDNA ORF Clone, Human, N-HA tag HG14526-NY
IDH2 cDNA ORF Clone, Human, C-Myc tag HG14526-CM
IDH2 cDNA ORF Clone, Human, N-Myc tag HG14526-NM
IDH2 qPCR Primer Pairs, Human HP103173
info info
添加购物车成功! 添加购物车失败!