Isocitrate dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag

Cat: HG12055-ANG

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Isocitrate dehydrogenase Reagents

CRO Services

Product recommended


All Isocitrate dehydrogenase Reagents

Isocitrate dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human isocitrate dehydrogenase 1 (NADP+), soluble with N terminal GFPSpark tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.98kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Isocitrate dehydrogenase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Isocitrate dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag Validated Images

Human IDH1 Gene Expression validated Image 909
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
Human aFGF/FGF1 Gene Plasmid Map 5636

Isocitrate dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag Alternative Names

HEL-216 cDNA ORF Clone, Human;HEL-S-26 cDNA ORF Clone, Human;IDCD cDNA ORF Clone, Human;IDH cDNA ORF Clone, Human;IDP cDNA ORF Clone, Human;IDPC cDNA ORF Clone, Human;PICD cDNA ORF Clone, Human

Isocitrate dehydrogenase Background Information

Full Name
isocitrate dehydrogenase 1 (NADP+), soluble
References
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Isocitrate dehydrogenase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Isocitrate dehydrogenase cDNA ORF Clone in Cloning Vector, Mouse MG52936-G
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, untagged MG52936-UT
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52936-ACG
    Isocitrate dehydrogenase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52936-ACGLN
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52936-ANG
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52936-ACR
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52936-ANR
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52936-CF
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52936-NF
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-His tag MG52936-CH
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-His tag MG52936-NH
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-HA tag MG52936-CY
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-HA tag MG52936-NY
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, C-Myc tag MG52936-CM
    Isocitrate dehydrogenase cDNA ORF Clone, Mouse, N-Myc tag MG52936-NM

    Isocitrate dehydrogenase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Isocitrate dehydrogenase cDNA ORF Clone in Cloning Vector, Human HG12055-G
    Isocitrate dehydrogenase cDNA ORF Clone, Human, untagged HG12055-UT
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-GFPSpark® tag HG12055-ACG
    Isocitrate dehydrogenase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12055-ACGLN
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-OFPSpark® tag HG12055-ACR
    Isocitrate dehydrogenase cDNA ORF Clone, Human, N-OFPSpark® tag HG12055-ANR
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12055-CF
    Isocitrate dehydrogenase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12055-NF
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-His tag HG12055-CH
    Isocitrate dehydrogenase cDNA ORF Clone, Human, N-His tag HG12055-NH
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-HA tag HG12055-G-Y
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-HA tag HG12055-CY
    Isocitrate dehydrogenase cDNA ORF Clone, Human, N-HA tag HG12055-NY
    Isocitrate dehydrogenase cDNA ORF Clone, Human, C-Myc tag HG12055-CM
    Isocitrate dehydrogenase cDNA ORF Clone, Human, N-Myc tag HG12055-NM
    Isocitrate dehydrogenase qPCR Primer Pairs, Human HP100077
    info info
    添加购物车成功! 添加购物车失败!