Quick Order

Human IDH1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human IDH1 cDNA Clone Product Information
NCBI RefSeq:NM_005896.2
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble.
Gene Synonym:IDH, IDP, IDCD, IDPC, PICD, IDH1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-IDH1
Restriction Site:KpnI + XbaI (6.1kb + 1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IDH1 Gene Plasmid Map
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Size / Price
    Catalog: HG12055-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"