HtrA2 / Omi cDNA ORF Clone, Human, N-HA tag

Cat: HG10619-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HtrA2 / Omi Reagents
CRO Services
Product recommended

All HtrA2 / Omi Reagents
HtrA2 / Omi cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1377 bp
Description
Full length Clone DNA of Human HtrA serine peptidase 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HtrA2 / Omi cDNA ORF Clone, Human, N-HA tag Alternative Names
OMI cDNA ORF Clone, Human;PARK13 cDNA ORF Clone, Human;PRSS25 cDNA ORF Clone, Human
HtrA2 / Omi Background Information

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

Full Name
HtrA serine peptidase 2
References
  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • info info
    添加购物车成功! 添加购物车失败!