Quick Order

Text Size:AAA

Human HtrA2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human HTRA2 cDNA Clone Product Information
NCBI RefSeq:NM_013247.4
RefSeq ORF Size:1377bp
cDNA Description:Full length Clone DNA of Homo sapiens HtrA serine peptidase 2 with C terminal Myc tag.
Gene Synonym:OMI, PARK13, PRSS25
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

References
  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"