Quick Order

Text Size:AAA

Human HtrA2 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human HTRA2 cDNA Clone Product Information
NCBI RefSeq:NM_013247.4
RefSeq ORF Size:1377bp
cDNA Description:Full length Clone DNA of Homo sapiens HtrA serine peptidase 2 with C terminal His tag.
Gene Synonym:OMI, PARK13, PRSS25
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

References
  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • Size / Price
    Catalog: HG10619-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"