HTR4/5-HT4 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10753-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HTR4/5-HT4 Reagents
CRO Services
Product recommended

All HTR4/5-HT4 Reagents
HTR4/5-HT4 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Description
Full length Clone DNA of Human 5-hydroxytryptamine (serotonin) receptor 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HTR4/5-HT4 cDNA ORF Clone, Human, C-Myc tag Alternative Names
5-HT4 cDNA ORF Clone, Human;5-HT4R cDNA ORF Clone, Human
HTR4/5-HT4 Background Information
Full Name
5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled

HTR4/5-HT4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HTR4/5-HT4 cDNA ORF Clone in Cloning Vector, Mouse MG51035-G
HTR4/5-HT4 cDNA ORF Clone, Mouse, untagged MG51035-UT
HTR4/5-HT4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51035-ACGLN
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51035-ACG
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51035-ACR
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51035-CF
HTR4/5-HT4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51035-NF
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-His tag MG51035-CH
HTR4/5-HT4 cDNA ORF Clone, Mouse, N-His tag MG51035-NH
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-HA tag MG51035-CY
HTR4/5-HT4 cDNA ORF Clone, Mouse, N-HA tag MG51035-NY
HTR4/5-HT4 cDNA ORF Clone, Mouse, C-Myc tag MG51035-CM
HTR4/5-HT4 cDNA ORF Clone, Mouse, N-Myc tag MG51035-NM
HTR4/5-HT4 qPCR Primer Pairs, Mouse MP200994

HTR4/5-HT4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HTR4/5-HT4 cDNA ORF Clone in Cloning Vector, Human HG10753-M
HTR4/5-HT4 cDNA ORF Clone, Human, untagged HG10753-UT
HTR4/5-HT4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10753-ACG
HTR4/5-HT4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10753-ACGLN
HTR4/5-HT4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10753-ACR
HTR4/5-HT4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10753-CF
HTR4/5-HT4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10753-NF
HTR4/5-HT4 cDNA ORF Clone, Human, C-His tag HG10753-CH
HTR4/5-HT4 cDNA ORF Clone, Human, N-His tag HG10753-NH
HTR4/5-HT4 cDNA ORF Clone, Human, C-HA tag HG10753-CY
HTR4/5-HT4 cDNA ORF Clone, Human, N-HA tag HG10753-NY
HTR4/5-HT4 cDNA ORF Clone, Human, N-Myc tag HG10753-NM
HTR4/5-HT4 qPCR Primer Pairs, Human HP100897
info info
添加购物车成功! 添加购物车失败!