Cpn10 cDNA ORF Clone, Human, untagged

Cat: HG11330-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cpn10 Reagents
CRO Services
Product recommended

All Cpn10 Reagents
Cpn10 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
309 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock 10kDa protein 1 (chaperonin 10).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI (6.1kb + 0.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Cpn10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cpn10 cDNA ORF Clone, Human, untagged Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5647
Cpn10 cDNA ORF Clone, Human, untagged Alternative Names
CPN10 cDNA ORF Clone, Human;EPF cDNA ORF Clone, Human;GROES cDNA ORF Clone, Human;HSP10 cDNA ORF Clone, Human
Cpn10 Background Information
Full Name
heat shock 10kDa protein 1

Cpn10 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
Cpn10 cDNA ORF Clone in Cloning Vector, Rabbit TG65105-G
Cpn10 cDNA ORF Clone, Rabbit, untagged TG65105-UT
Cpn10 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65105-ACG
Cpn10 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65105-ANG
Cpn10 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65105-ACR
Cpn10 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65105-ANR
Cpn10 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65105-CF
Cpn10 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65105-NF
Cpn10 cDNA ORF Clone, Rabbit, C-His tag TG65105-CH
Cpn10 cDNA ORF Clone, Rabbit, N-His tag TG65105-NH
Cpn10 cDNA ORF Clone, Rabbit, C-HA tag TG65105-CY
Cpn10 cDNA ORF Clone, Rabbit, N-HA tag TG65105-NY
Cpn10 cDNA ORF Clone, Rabbit, C-Myc tag TG65105-CM
Cpn10 cDNA ORF Clone, Rabbit, N-Myc tag TG65105-NM

Cpn10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cpn10 cDNA ORF Clone in Cloning Vector, Rat RG80802-U
Cpn10 cDNA ORF Clone, Rat, untagged RG80802-UT
Cpn10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80802-ACG
Cpn10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80802-ACGLN
Cpn10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80802-ANG
Cpn10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80802-ACR
Cpn10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80802-ANR
Cpn10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80802-CF
Cpn10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80802-NF
Cpn10 cDNA ORF Clone, Rat, C-His tag RG80802-CH
Cpn10 cDNA ORF Clone, Rat, N-His tag RG80802-NH
Cpn10 cDNA ORF Clone, Rat, C-HA tag RG80802-CY
Cpn10 cDNA ORF Clone, Rat, N-HA tag RG80802-NY
Cpn10 cDNA ORF Clone, Rat, C-Myc tag RG80802-CM
Cpn10 cDNA ORF Clone, Rat, N-Myc tag RG80802-NM
Cpn10 qPCR Primer Pairs, Rat RP300766

Cpn10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cpn10 cDNA ORF Clone in Cloning Vector, Human HG11330-M
Cpn10 cDNA ORF Clone, Human, C-GFPSpark® tag HG11330-ACG
Cpn10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11330-ACGLN
Cpn10 cDNA ORF Clone, Human, N-GFPSpark® tag HG11330-ANG
Cpn10 cDNA ORF Clone, Human, C-OFPSpark® tag HG11330-ACR
Cpn10 cDNA ORF Clone, Human, N-OFPSpark® tag HG11330-ANR
Cpn10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11330-CF
Cpn10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11330-NF
Cpn10 cDNA ORF Clone, Human, C-His tag HG11330-CH
Cpn10 cDNA ORF Clone, Human, N-His tag HG11330-NH
Cpn10 cDNA ORF Clone, Human, C-HA tag HG11330-CY
Cpn10 cDNA ORF Clone, Human, N-HA tag HG11330-NY
Cpn10 cDNA ORF Clone, Human, C-Myc tag HG11330-CM
Cpn10 cDNA ORF Clone, Human, N-Myc tag HG11330-NM
Cpn10 qPCR Primer Pairs, Human HP101215
info info
添加购物车成功! 添加购物车失败!