HSPB8/Cryac cDNA ORF Clone, Human, N-HA tag

Cat: HG10666-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSPB8/Cryac Reagents
CRO Services
Product recommended

All HSPB8/Cryac Reagents
HSPB8/Cryac cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Human heat shock 22kDa protein 8 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSPB8/Cryac cDNA ORF Clone, Human, N-HA tag Alternative Names
CMT2L cDNA ORF Clone, Human;DHMN2 cDNA ORF Clone, Human;E2IG1 cDNA ORF Clone, Human;H11 cDNA ORF Clone, Human;HMN2 cDNA ORF Clone, Human;HMN2A cDNA ORF Clone, Human;HSP22 cDNA ORF Clone, Human
HSPB8/Cryac Background Information
Full Name
heat shock 22kDa protein 8

HSPB8/Cryac cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSPB8/Cryac cDNA ORF Clone in Cloning Vector, Rat RG80864-U
HSPB8/Cryac cDNA ORF Clone, Rat, untagged RG80864-UT
HSPB8/Cryac cDNA ORF Clone, Rat, C-GFPSpark® tag RG80864-ACG
HSPB8/Cryac Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80864-ACGLN
HSPB8/Cryac cDNA ORF Clone, Rat, N-GFPSpark® tag RG80864-ANG
HSPB8/Cryac cDNA ORF Clone, Rat, C-OFPSpark® tag RG80864-ACR
HSPB8/Cryac cDNA ORF Clone, Rat, N-OFPSpark® tag RG80864-ANR
HSPB8/Cryac cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80864-CF
HSPB8/Cryac cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80864-NF
HSPB8/Cryac cDNA ORF Clone, Rat, C-His tag RG80864-CH
HSPB8/Cryac cDNA ORF Clone, Rat, N-His tag RG80864-NH
HSPB8/Cryac cDNA ORF Clone, Rat, C-HA tag RG80864-CY
HSPB8/Cryac cDNA ORF Clone, Rat, N-HA tag RG80864-NY
HSPB8/Cryac cDNA ORF Clone, Rat, C-Myc tag RG80864-CM
HSPB8/Cryac cDNA ORF Clone, Rat, N-Myc tag RG80864-NM
HSPB8/Cryac qPCR Primer Pairs, Rat RP300828

HSPB8/Cryac cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSPB8/Cryac cDNA ORF Clone in Cloning Vector, Mouse MG50839-G
HSPB8/Cryac cDNA ORF Clone, Mouse, untagged MG50839-UT
HSPB8/Cryac Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50839-ACGLN
HSPB8/Cryac cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50839-ACG
HSPB8/Cryac cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50839-ANG
HSPB8/Cryac cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50839-ACR
HSPB8/Cryac cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50839-ANR
HSPB8/Cryac cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50839-CF
HSPB8/Cryac cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50839-NF
HSPB8/Cryac cDNA ORF Clone, Mouse, C-His tag MG50839-CH
HSPB8/Cryac cDNA ORF Clone, Mouse, N-His tag MG50839-NH
HSPB8/Cryac cDNA ORF Clone, Mouse, C-HA tag MG50839-CY
HSPB8/Cryac cDNA ORF Clone, Mouse, N-HA tag MG50839-NY
HSPB8/Cryac cDNA ORF Clone, Mouse, C-Myc tag MG50839-CM
HSPB8/Cryac cDNA ORF Clone, Mouse, N-Myc tag MG50839-NM
HSPB8/Cryac qPCR Primer Pairs, Mouse MP200810

HSPB8/Cryac cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSPB8/Cryac cDNA ORF Clone in Cloning Vector, Human HG10666-M
HSPB8/Cryac cDNA ORF Clone, Human, untagged HG10666-UT
HSPB8/Cryac Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10666-ACGLN
HSPB8/Cryac cDNA ORF Clone, Human, C-GFPSpark® tag HG10666-ACG
HSPB8/Cryac cDNA ORF Clone, Human, N-GFPSpark® tag HG10666-ANG
HSPB8/Cryac cDNA ORF Clone, Human, C-OFPSpark® tag HG10666-ACR
HSPB8/Cryac cDNA ORF Clone, Human, N-OFPSpark® tag HG10666-ANR
HSPB8/Cryac cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10666-CF
HSPB8/Cryac cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10666-NF
HSPB8/Cryac cDNA ORF Clone, Human, C-His tag HG10666-CH
HSPB8/Cryac cDNA ORF Clone, Human, N-His tag HG10666-NH
HSPB8/Cryac cDNA ORF Clone, Human, C-HA tag HG10666-CY
HSPB8/Cryac cDNA ORF Clone, Human, C-Myc tag HG10666-CM
HSPB8/Cryac cDNA ORF Clone, Human, N-Myc tag HG10666-NM
HSPB8/Cryac qPCR Primer Pairs, Human HP100633
info info
添加购物车成功! 添加购物车失败!