Quick Order

Human HSPA5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HSPA5 cDNA Clone Product Information
NCBI RefSeq:NM_005347.4
RefSeq ORF Size:1965bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa).
Gene Synonym:BIP, MIF2, GRP78, FLJ26106, HSPA5
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HSPA5
Restriction Site:KpnI + XbaI (6.1kb + 1.97kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 6 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12063-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"