HSP70 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11660-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSP70 Reagents
CRO Services
Product recommended

All HSP70 Reagents
HSP70 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1926 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 222 T>C not causing the amino acid variation.
Description
Full length Clone DNA of Human heat shock 70kDa protein 1A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.98kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
HSP70 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSP70 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human HSP70/HSPA1A Gene Expression validated Image 1841
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
HSP70 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HEL-S-103 cDNA ORF Clone, Human;HSP70-1 cDNA ORF Clone, Human;HSP70-1A cDNA ORF Clone, Human;HSP70I cDNA ORF Clone, Human;HSP72 cDNA ORF Clone, Human;HSPA1 cDNA ORF Clone, Human
HSP70 Background Information

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release. 

Full Name
heat shock 70kDa protein 1A
References
  • Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.
  • Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.
  • Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.
  • HSP70 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HSP70 cDNA ORF Clone, Mouse, untagged MG57562-UT
    HSP70 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57562-ACGLN
    HSP70 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57562-ACG
    HSP70 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57562-ANG
    HSP70 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57562-ACR
    HSP70 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57562-ANR
    HSP70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57562-CF
    HSP70 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57562-NF
    HSP70 cDNA ORF Clone, Mouse, C-His tag MG57562-CH
    HSP70 cDNA ORF Clone, Mouse, N-His tag MG57562-NH
    HSP70 cDNA ORF Clone, Mouse, C-HA tag MG57562-CY
    HSP70 cDNA ORF Clone, Mouse, N-HA tag MG57562-NY
    HSP70 cDNA ORF Clone, Mouse, C-Myc tag MG57562-CM
    HSP70 cDNA ORF Clone, Mouse, N-Myc tag MG57562-NM

    HSP70 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HSP70 cDNA ORF Clone in Cloning Vector, Human HG11660-M
    HSP70 cDNA ORF Clone, Human, untagged HG11660-UT
    HSP70 cDNA ORF Clone, Human, C-GFPSpark® tag HG11660-ACG
    HSP70 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11660-ACGLN
    HSP70 cDNA ORF Clone, Human, N-GFPSpark® tag HG11660-ANG
    HSP70 cDNA ORF Clone, Human, C-OFPSpark® tag HG11660-ACR
    HSP70 cDNA ORF Clone, Human, N-OFPSpark® tag HG11660-ANR
    HSP70 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11660-NF
    HSP70 cDNA ORF Clone, Human, C-His tag HG11660-CH
    HSP70 cDNA ORF Clone, Human, N-His tag HG11660-NH
    HSP70 cDNA ORF Clone, Human, C-HA tag HG11660-CY
    HSP70 cDNA ORF Clone, Human, N-HA tag HG11660-NY
    HSP70 cDNA ORF Clone, Human, C-Myc tag HG11660-CM
    HSP70 cDNA ORF Clone, Human, N-Myc tag HG11660-NM
    HSP70 qPCR Primer Pairs, Human HP101505
    info info
    添加购物车成功! 添加购物车失败!