HSDL2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14809-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSDL2 Reagents
CRO Services
Product recommended

All HSDL2 Reagents
HSDL2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Human hydroxysteroid dehydrogenase like 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSDL2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
C9orf99 cDNA ORF Clone, Human;SDR13C1 cDNA ORF Clone, Human
HSDL2 Background Information
Full Name
hydroxysteroid dehydrogenase like 2

HSDL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSDL2 cDNA ORF Clone in Cloning Vector, Mouse MG52416-G
HSDL2 cDNA ORF Clone, Mouse, untagged MG52416-UT
HSDL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52416-ACGLN
HSDL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52416-ACG
HSDL2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52416-ANG
HSDL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52416-ACR
HSDL2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52416-ANR
HSDL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52416-CF
HSDL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52416-NF
HSDL2 cDNA ORF Clone, Mouse, C-His tag MG52416-CH
HSDL2 cDNA ORF Clone, Mouse, N-His tag MG52416-NH
HSDL2 cDNA ORF Clone, Mouse, C-HA tag MG52416-CY
HSDL2 cDNA ORF Clone, Mouse, N-HA tag MG52416-NY
HSDL2 cDNA ORF Clone, Mouse, C-Myc tag MG52416-CM
HSDL2 cDNA ORF Clone, Mouse, N-Myc tag MG52416-NM
HSDL2 qPCR Primer Pairs, Mouse MP202289

HSDL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSDL2 cDNA ORF Clone in Cloning Vector, Human HG14809-G
HSDL2 cDNA ORF Clone, Human, untagged HG14809-UT
HSDL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14809-ACG
HSDL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14809-ACGLN
HSDL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14809-ANG
HSDL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14809-ACR
HSDL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14809-ANR
HSDL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14809-CF
HSDL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14809-NF
HSDL2 cDNA ORF Clone, Human, C-His tag HG14809-CH
HSDL2 cDNA ORF Clone, Human, N-His tag HG14809-NH
HSDL2 cDNA ORF Clone, Human, C-HA tag HG14809-CY
HSDL2 cDNA ORF Clone, Human, N-HA tag HG14809-NY
HSDL2 cDNA ORF Clone, Human, N-Myc tag HG14809-NM
HSDL2 qPCR Primer Pairs, Human HP103441
info info
添加购物车成功! 添加购物车失败!