HSD17B11 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13259-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSD17B11 Reagents
CRO Services
Product recommended

All HSD17B11 Reagents
HSD17B11 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
903 bp
Description
Full length Clone DNA of Human hydroxysteroid (17-beta) dehydrogenase 11 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD17B11 cDNA ORF Clone, Human, N-Myc tag Alternative Names
17-BETA-HSD11 cDNA ORF Clone, Human;17-BETA-HSDXI cDNA ORF Clone, Human;17BHSD11 cDNA ORF Clone, Human;DHRS8 cDNA ORF Clone, Human;PAN1B cDNA ORF Clone, Human;RETSDR2 cDNA ORF Clone, Human;SDR16C2 cDNA ORF Clone, Human
HSD17B11 Background Information
Full Name
hydroxysteroid (17-beta) dehydrogenase 11

HSD17B11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSD17B11 cDNA ORF Clone in Cloning Vector, Rat RG80509-U
HSD17B11 cDNA ORF Clone, Rat, untagged RG80509-UT
HSD17B11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80509-ACGLN
HSD17B11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80509-ACG
HSD17B11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80509-ACR
HSD17B11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80509-CF
HSD17B11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80509-NF
HSD17B11 cDNA ORF Clone, Rat, C-His tag RG80509-CH
HSD17B11 cDNA ORF Clone, Rat, N-His tag RG80509-NH
HSD17B11 cDNA ORF Clone, Rat, C-HA tag RG80509-CY
HSD17B11 cDNA ORF Clone, Rat, N-HA tag RG80509-NY
HSD17B11 cDNA ORF Clone, Rat, C-Myc tag RG80509-CM
HSD17B11 cDNA ORF Clone, Rat, N-Myc tag RG80509-NM
HSD17B11 qPCR Primer Pairs, Rat RP300473

HSD17B11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD17B11 cDNA ORF Clone in Cloning Vector, Human HG13259-G
HSD17B11 cDNA ORF Clone, Human, untagged HG13259-UT
HSD17B11 cDNA ORF Clone, Human, C-GFPSpark® tag HG13259-ACG
HSD17B11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13259-ACGLN
HSD17B11 cDNA ORF Clone, Human, C-OFPSpark® tag HG13259-ACR
HSD17B11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13259-CF
HSD17B11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13259-NF
HSD17B11 cDNA ORF Clone, Human, C-His tag HG13259-CH
HSD17B11 cDNA ORF Clone, Human, N-His tag HG13259-NH
HSD17B11 cDNA ORF Clone, Human, C-HA tag HG13259-CY
HSD17B11 cDNA ORF Clone, Human, N-HA tag HG13259-NY
HSD17B11 cDNA ORF Clone, Human, C-Myc tag HG13259-CM
HSD17B11 qPCR Primer Pairs, Human HP101968
info info
添加购物车成功! 添加购物车失败!