HRSP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14512-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HRSP12 Reagents
CRO Services
Product recommended

All HRSP12 Reagents
HRSP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
414 bp
Description
Full length Clone DNA of Human heat-responsive protein 12 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HRSP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
P14.5 cDNA ORF Clone, Human;PSP cDNA ORF Clone, Human;UK114 cDNA ORF Clone, Human
HRSP12 Background Information
Full Name
heat-responsive protein 12

HRSP12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HRSP12 cDNA ORF Clone in Cloning Vector, Mouse MG52483-U
HRSP12 cDNA ORF Clone, Mouse, untagged MG52483-UT
HRSP12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52483-ACG
HRSP12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52483-ACGLN
HRSP12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52483-ANG
HRSP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52483-ACR
HRSP12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52483-ANR
HRSP12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52483-CF
HRSP12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52483-NF
HRSP12 cDNA ORF Clone, Mouse, C-His tag MG52483-CH
HRSP12 cDNA ORF Clone, Mouse, N-His tag MG52483-NH
HRSP12 cDNA ORF Clone, Mouse, C-HA tag MG52483-CY
HRSP12 cDNA ORF Clone, Mouse, N-HA tag MG52483-NY
HRSP12 cDNA ORF Clone, Mouse, C-Myc tag MG52483-CM
HRSP12 cDNA ORF Clone, Mouse, N-Myc tag MG52483-NM
HRSP12 qPCR Primer Pairs, Mouse MP202356

HRSP12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HRSP12 cDNA ORF Clone in Cloning Vector, Human HG14512-G
HRSP12 cDNA ORF Clone, Human, untagged HG14512-UT
HRSP12 cDNA ORF Clone, Human, C-GFPSpark® tag HG14512-ACG
HRSP12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14512-ACGLN
HRSP12 cDNA ORF Clone, Human, N-GFPSpark® tag HG14512-ANG
HRSP12 cDNA ORF Clone, Human, C-OFPSpark® tag HG14512-ACR
HRSP12 cDNA ORF Clone, Human, N-OFPSpark® tag HG14512-ANR
HRSP12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14512-NF
HRSP12 cDNA ORF Clone, Human, C-His tag HG14512-CH
HRSP12 cDNA ORF Clone, Human, N-His tag HG14512-NH
HRSP12 cDNA ORF Clone, Human, C-HA tag HG14512-CY
HRSP12 cDNA ORF Clone, Human, N-HA tag HG14512-NY
HRSP12 cDNA ORF Clone, Human, C-Myc tag HG14512-CM
HRSP12 cDNA ORF Clone, Human, N-Myc tag HG14512-NM
HRSP12 qPCR Primer Pairs, Human HP103159
info info
添加购物车成功! 添加购物车失败!