Quick Order

Text Size:AAA

Human HRG / HPRG ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human HRG cDNA Clone Product Information
NCBI RefSeq:NM_000412.2
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Homo sapiens histidine-rich glycoprotein with N terminal Myc tag.
Gene Synonym:HPRG, HRGP, DKFZp779H1622, HRG
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Histidine-rich glycoprotein, also known as HRG and HPRG, is a glycoprotein located in plasma and platelets, and contains an unusually large amount of histidine and proline. In human, five distinct domains are recognized in the mature HPRG molecule. There are two N-terminal cystatin-like modules (aa 19 - 254) and one His-Pro-rich region (aa 350 - 497) that is flanked by two Pro-rich segments (aa 276 - 321 and 498 - 525). The His-Pro-rich region contains 10 tandem repeats with an HHPHG motif, and the N- and C-termini are linked by a disulfide bond. The specific functions of HRG remain unclear, but it is known that the protein binds heme, dyes and divalent metal ions. It inhibits rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. HPRG is evolutionarily, functionally and structurally related to cleaved high molecular weight kininogen (HKa), an anti-angiogenic polypeptide that stimulates apoptosis of proliferating endothelial cells through binding to cell-surface tropomyosin. The antiangiogenic activity of the multidomain plasma protein HPRG is localized to its histidine-proline-rich (H/P) domain and has recently been shown to be mediated, at least partially, through binding to cell-surface tropomyosin in fibroblast growth factor-2-activated endothelial cells.

References
  • Guan X, et al. (2004) Histidine-proline rich glycoprotein (HPRG) binds and transduces anti-angiogenic signals through cell surface tropomyosin on endothelial cells. Thromb Haemost. 92(2): 403-12.
  • Doate F, et al. (2004) Peptides derived from the histidine-proline domain of the histidine-proline-rich glycoprotein bind to tropomyosin and have antiangiogenic and antitumor activities. Cancer Res. 64(16): 5812-7.
  • Size / Price
    Catalog: HG10836-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"