15-PGDH cDNA ORF Clone, Human, C-His tag

Cat: HG11205-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All 15-PGDH Reagents
CRO Services
Product recommended

All 15-PGDH Reagents
15-PGDH cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Human hydroxyprostaglandin dehydrogenase 15-(NAD), transcript variant 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

15-PGDH cDNA ORF Clone, Human, C-His tag Alternative Names
15-PGDH cDNA ORF Clone, Human;PGDH cDNA ORF Clone, Human;PGDH1 cDNA ORF Clone, Human;PHOAR1 cDNA ORF Clone, Human;SDR36C1 cDNA ORF Clone, Human
15-PGDH Background Information

15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.

Full Name
hydroxyprostaglandin dehydrogenase 15-(NAD)
References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • 15-PGDH cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    15-PGDH cDNA ORF Clone in Cloning Vector, Rat RG84114-U
    15-PGDH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84114-ACGLN

    15-PGDH cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    15-PGDH cDNA ORF Clone in Cloning Vector, Mouse MG50531-M
    15-PGDH cDNA ORF Clone, Mouse, untagged MG50531-UT
    15-PGDH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50531-ACGLN
    15-PGDH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50531-ACG
    15-PGDH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50531-ANG
    15-PGDH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50531-ACR
    15-PGDH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50531-ANR
    15-PGDH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50531-CF
    15-PGDH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50531-NF
    15-PGDH cDNA ORF Clone, Mouse, C-His tag MG50531-CH
    15-PGDH cDNA ORF Clone, Mouse, N-His tag MG50531-NH
    15-PGDH cDNA ORF Clone, Mouse, C-HA tag MG50531-CY
    15-PGDH cDNA ORF Clone, Mouse, N-HA tag MG50531-NY
    15-PGDH cDNA ORF Clone, Mouse, C-Myc tag MG50531-CM
    15-PGDH cDNA ORF Clone, Mouse, N-Myc tag MG50531-NM
    15-PGDH qPCR Primer Pairs, Mouse MP200523

    15-PGDH cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    15-PGDH cDNA ORF Clone in Cloning Vector, Human HG11205-M
    15-PGDH cDNA ORF Clone, Human, untagged HG11205-UT
    15-PGDH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11205-ACGLN
    15-PGDH cDNA ORF Clone, Human, C-GFPSpark® tag HG11205-ACG
    15-PGDH cDNA ORF Clone, Human, N-GFPSpark® tag HG11205-ANG
    15-PGDH cDNA ORF Clone, Human, C-OFPSpark® tag HG11205-ACR
    15-PGDH cDNA ORF Clone, Human, N-OFPSpark® tag HG11205-ANR
    15-PGDH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11205-CF
    15-PGDH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11205-NF
    15-PGDH cDNA ORF Clone, Human, N-His tag HG11205-NH
    15-PGDH cDNA ORF Clone, Human, C-HA tag HG11205-CY
    15-PGDH cDNA ORF Clone, Human, N-HA tag HG11205-NY
    15-PGDH cDNA ORF Clone, Human, C-Myc tag HG11205-CM
    15-PGDH cDNA ORF Clone, Human, N-Myc tag HG11205-NM
    15-PGDH qPCR Primer Pairs, Human HP100056
    info info
    添加购物车成功! 添加购物车失败!