Quick Order

Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human HPGD cDNA Clone Product Information
NCBI RefSeq:NM_000860.4
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD), transcript variant 1 with C terminal HA tag.
Gene Synonym:PGDH, PGDH1, 15-PGDH, SDR36C1, HPGD
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11205-ACG$225
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11205-ACR$225
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11205-ANG$225
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11205-ANR$225
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11205-CF$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG11205-CH$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11205-CM$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG11205-CY$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11205-M$75
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11205-M-F$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11205-NF$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG11205-NH$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11205-NM$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG11205-NY$195
Human HPGD/15-PGDH transcript variant 1 Gene ORF cDNA clone expression plasmidHG11205-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Mouse 15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.

References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • Size / Price
    Catalog: HG11205-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"