Haptoglobin cDNA ORF Clone, Human, N-Myc tag

Cat: HG13792-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Haptoglobin Reagents
CRO Services
Product recommended

All Haptoglobin Reagents
Haptoglobin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human haptoglobin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Haptoglobin cDNA ORF Clone, Human, N-Myc tag Alternative Names
BP cDNA ORF Clone, Human;HP2ALPHA2 cDNA ORF Clone, Human;HPA1S cDNA ORF Clone, Human
Haptoglobin Background Information
Full Name
haptoglobin

Haptoglobin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Haptoglobin cDNA ORF Clone in Cloning Vector, Rat RG80534-U
Haptoglobin cDNA ORF Clone, Rat, untagged RG80534-UT
Haptoglobin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80534-ACGLN
Haptoglobin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80534-ACG
Haptoglobin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80534-ACR
Haptoglobin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80534-CF
Haptoglobin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80534-NF
Haptoglobin cDNA ORF Clone, Rat, C-His tag RG80534-CH
Haptoglobin cDNA ORF Clone, Rat, N-His tag RG80534-NH
Haptoglobin cDNA ORF Clone, Rat, C-HA tag RG80534-CY
Haptoglobin cDNA ORF Clone, Rat, N-HA tag RG80534-NY
Haptoglobin cDNA ORF Clone, Rat, C-Myc tag RG80534-CM
Haptoglobin cDNA ORF Clone, Rat, N-Myc tag RG80534-NM
Haptoglobin qPCR Primer Pairs, Rat RP300498

Haptoglobin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Haptoglobin cDNA ORF Clone in Cloning Vector, Mouse MG53242-U
Haptoglobin cDNA ORF Clone, Mouse, untagged MG53242-UT
Haptoglobin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53242-ACG
Haptoglobin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53242-ACGLN
Haptoglobin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53242-ACR
Haptoglobin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53242-CF
Haptoglobin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53242-NF
Haptoglobin cDNA ORF Clone, Mouse, C-His tag MG53242-CH
Haptoglobin cDNA ORF Clone, Mouse, N-His tag MG53242-NH
Haptoglobin cDNA ORF Clone, Mouse, C-HA tag MG53242-CY
Haptoglobin cDNA ORF Clone, Mouse, N-HA tag MG53242-NY
Haptoglobin cDNA ORF Clone, Mouse, C-Myc tag MG53242-CM
Haptoglobin cDNA ORF Clone, Mouse, N-Myc tag MG53242-NM

Haptoglobin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Haptoglobin cDNA ORF Clone in Cloning Vector, Human HG13792-G
Haptoglobin cDNA ORF Clone, Human, untagged HG13792-UT
Haptoglobin cDNA ORF Clone, Human, C-GFPSpark® tag HG13792-ACG
Haptoglobin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13792-ACGLN
Haptoglobin cDNA ORF Clone, Human, C-OFPSpark® tag HG13792-ACR
Haptoglobin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13792-CF
Haptoglobin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13792-NF
Haptoglobin cDNA ORF Clone, Human, C-His tag HG13792-CH
Haptoglobin cDNA ORF Clone, Human, N-His tag HG13792-NH
Haptoglobin cDNA ORF Clone, Human, C-HA tag HG13792-CY
Haptoglobin cDNA ORF Clone, Human, N-HA tag HG13792-NY
Haptoglobin cDNA ORF Clone, Human, C-Myc tag HG13792-CM
Haptoglobin qPCR Primer Pairs, Human HP104898
info info
添加购物车成功! 添加购物车失败!