Quick Order

Human HOXC10 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HOXC10 cDNA Clone Product Information
NCBI RefSeq:BC001293
RefSeq ORF Size:1029bp
cDNA Description:Full length Clone DNA of Homo sapiens homeobox C10 DNA.
Gene Synonym:HOX3I
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HOXC10
Restriction Site:HindIII + XbaI(6.1kb+1.03kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HOXC10 qPCR primers for gene expression analysis, HP104047 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG15423-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"