HOMER2 cDNA ORF Clone, Human, untagged

Cat: HG14399-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HOMER2 Reagents
CRO Services
Product recommended

All HOMER2 Reagents
HOMER2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Description
Full length Clone DNA of Human homer homolog 2 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HOMER2 cDNA ORF Clone, Human, untagged Alternative Names
ACPD cDNA ORF Clone, Human;CPD cDNA ORF Clone, Human;HOMER-2 cDNA ORF Clone, Human;VESL-2 cDNA ORF Clone, Human
HOMER2 Background Information
Full Name
homer scaffolding protein 2

HOMER2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HOMER2 cDNA ORF Clone in Cloning Vector, Mouse MG51530-G
HOMER2 cDNA ORF Clone, Mouse, untagged MG51530-UT
HOMER2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51530-ACG
HOMER2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51530-ACGLN
HOMER2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51530-ANG
HOMER2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51530-ACR
HOMER2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51530-ANR
HOMER2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51530-CF
HOMER2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51530-NF
HOMER2 cDNA ORF Clone, Mouse, C-His tag MG51530-CH
HOMER2 cDNA ORF Clone, Mouse, N-His tag MG51530-NH
HOMER2 cDNA ORF Clone, Mouse, C-HA tag MG51530-CY
HOMER2 cDNA ORF Clone, Mouse, N-HA tag MG51530-NY
HOMER2 cDNA ORF Clone, Mouse, C-Myc tag MG51530-CM
HOMER2 cDNA ORF Clone, Mouse, N-Myc tag MG51530-NM
HOMER2 qPCR Primer Pairs, Mouse MP201414

HOMER2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HOMER2 cDNA ORF Clone in Cloning Vector, Human HG14399-G
HOMER2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14399-ACG
HOMER2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14399-ACGLN
HOMER2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14399-ANG
HOMER2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14399-ACR
HOMER2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14399-ANR
HOMER2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14399-CF
HOMER2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14399-NF
HOMER2 cDNA ORF Clone, Human, C-His tag HG14399-CH
HOMER2 cDNA ORF Clone, Human, N-His tag HG14399-NH
HOMER2 cDNA ORF Clone, Human, C-HA tag HG14399-CY
HOMER2 cDNA ORF Clone, Human, N-HA tag HG14399-NY
HOMER2 cDNA ORF Clone, Human, C-Myc tag HG14399-CM
HOMER2 cDNA ORF Clone, Human, N-Myc tag HG14399-NM
HOMER2 qPCR Primer Pairs, Human HP103048
info info
添加购物车成功! 添加购物车失败!