Quick Order

Human HNRNP R / HNRNPR Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human HNRNPR cDNA Clone Product Information
NCBI RefSeq:BC001449
RefSeq ORF Size:1911bp
cDNA Description:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein R.
Gene Synonym:FLJ25714, HNRPR, hnRNP R, hnRNP-R, HNRNPR
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

HNRNP R, also known as HNRNPR, is a RNA binding protein. HNRNP R gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). HnRNPs complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. HNRNP R has three repeats of quasi-RRM domains that bind to RNAs and also contains a nuclear localization motif.

References
  • Rossoll, et al. (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons?. Hum Mol Genet. 11 (1):93-105.
  • Mourelatos, Z, et al. (2001) SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J. 20(19):5443-52.
  • Hassfeld W, et al. (1998) Molecular definition of heterogeneous nuclear ribonucleoprotein R (hnRNP R) using autoimmune antibody: immunological relationship with hnRNP P. Nucleic Acids Res. 26(2):439-45.
  • Size / Price
    Catalog: HG14309-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"