HNRNPK cDNA ORF Clone, Human, N-HA tag

Cat: HG14077-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HNRNPK Reagents
CRO Services
Product recommended

All HNRNPK Reagents
HNRNPK cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1392 bp
Description
Full length Clone DNA of Human heterogeneous nuclear ribonucleoprotein K with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPK cDNA ORF Clone, Human, N-HA tag Alternative Names
AUKS cDNA ORF Clone, Human;CSBP cDNA ORF Clone, Human;HNRPK cDNA ORF Clone, Human;TUNP cDNA ORF Clone, Human
HNRNPK Background Information
Full Name
heterogeneous nuclear ribonucleoprotein K

HNRNPK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HNRNPK cDNA ORF Clone in Cloning Vector, Rat RG83233-U
HNRNPK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83233-ACGLN

HNRNPK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNRNPK cDNA ORF Clone in Cloning Vector, Mouse MG53688-U
HNRNPK cDNA ORF Clone, Mouse, untagged MG53688-UT
HNRNPK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53688-ACGLN
HNRNPK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53688-ACG
HNRNPK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53688-ANG
HNRNPK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53688-ACR
HNRNPK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53688-ANR
HNRNPK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53688-CF
HNRNPK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53688-NF
HNRNPK cDNA ORF Clone, Mouse, C-His tag MG53688-CH
HNRNPK cDNA ORF Clone, Mouse, N-His tag MG53688-NH
HNRNPK cDNA ORF Clone, Mouse, C-HA tag MG53688-CY
HNRNPK cDNA ORF Clone, Mouse, N-HA tag MG53688-NY
HNRNPK cDNA ORF Clone, Mouse, C-Myc tag MG53688-CM
HNRNPK cDNA ORF Clone, Mouse, N-Myc tag MG53688-NM

HNRNPK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPK cDNA ORF Clone in Cloning Vector, Human HG16029-G
HNRNPK cDNA ORF Clone in Cloning Vector, Human HG14077-G
HNRNPK cDNA ORF Clone, Human, untagged HG16029-UT
HNRNPK cDNA ORF Clone, Human, untagged HG14077-UT
HNRNPK cDNA ORF Clone, Human, C-GFPSpark® tag HG14077-ACG
HNRNPK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14077-ACGLN
HNRNPK cDNA ORF Clone, Human, C-GFPSpark® tag HG16029-ACG
HNRNPK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16029-ACGLN
HNRNPK cDNA ORF Clone, Human, N-GFPSpark® tag HG14077-ANG
HNRNPK cDNA ORF Clone, Human, C-OFPSpark® tag HG16029-ACR
HNRNPK cDNA ORF Clone, Human, C-OFPSpark® tag HG14077-ACR
HNRNPK cDNA ORF Clone, Human, N-OFPSpark® tag HG14077-ANR
HNRNPK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16029-CF
HNRNPK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14077-CF
HNRNPK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16029-NF
HNRNPK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14077-NF
HNRNPK cDNA ORF Clone, Human, C-His tag HG14077-G-H
HNRNPK cDNA ORF Clone, Human, C-His tag HG16029-CH
HNRNPK cDNA ORF Clone, Human, C-His tag HG14077-CH
HNRNPK cDNA ORF Clone, Human, N-His tag HG14077-NH
HNRNPK cDNA ORF Clone, Human, N-His tag HG16029-NH
HNRNPK cDNA ORF Clone, Human, C-HA tag HG16029-CY
HNRNPK cDNA ORF Clone, Human, C-HA tag HG14077-CY
HNRNPK cDNA ORF Clone, Human, N-HA tag HG16029-NY
HNRNPK cDNA ORF Clone, Human, C-Myc tag HG16029-CM
HNRNPK cDNA ORF Clone, Human, C-Myc tag HG14077-CM
HNRNPK cDNA ORF Clone, Human, N-Myc tag HG14077-NM
HNRNPK cDNA ORF Clone, Human, N-Myc tag HG16029-NM
HNRNPK qPCR Primer Pairs, Human HP102731
info info
添加购物车成功! 添加购物车失败!