HNRNPF cDNA ORF Clone, Human, C-Myc tag

Cat: HG14268-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HNRNPF Reagents
CRO Services
Product recommended

All HNRNPF Reagents
HNRNPF cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Human heterogeneous nuclear ribonucleoprotein F with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPF cDNA ORF Clone, Human, C-Myc tag Alternative Names
HNRPF cDNA ORF Clone, Human;mcs94-1 cDNA ORF Clone, Human;OK/SW-cl.23 cDNA ORF Clone, Human
HNRNPF Background Information
Full Name
heterogeneous nuclear ribonucleoprotein F

HNRNPF cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Ferret FG60063-G
HNRNPF cDNA ORF Clone, Ferret, untagged FG60063-UT
HNRNPF Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60063-ACGLN
HNRNPF cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60063-ACG
HNRNPF cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60063-ANG
HNRNPF cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60063-ACR
HNRNPF cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60063-ANR
HNRNPF cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60063-CF
HNRNPF cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60063-NF
HNRNPF cDNA ORF Clone, Ferret, C-His tag FG60063-CH
HNRNPF cDNA ORF Clone, Ferret, N-His tag FG60063-NH
HNRNPF cDNA ORF Clone, Ferret, C-HA tag FG60063-CY
HNRNPF cDNA ORF Clone, Ferret, N-HA tag FG60063-NY
HNRNPF cDNA ORF Clone, Ferret, C-Myc tag FG60063-CM
HNRNPF cDNA ORF Clone, Ferret, N-Myc tag FG60063-NM

HNRNPF cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Rat RG81417-G

HNRNPF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Human HG14268-G
HNRNPF cDNA ORF Clone, Human, untagged HG14268-UT
HNRNPF cDNA ORF Clone, Human, C-GFPSpark® tag HG14268-ACG
HNRNPF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14268-ACGLN
HNRNPF cDNA ORF Clone, Human, N-GFPSpark® tag HG14268-ANG
HNRNPF cDNA ORF Clone, Human, C-OFPSpark® tag HG14268-ACR
HNRNPF cDNA ORF Clone, Human, N-OFPSpark® tag HG14268-ANR
HNRNPF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14268-CF
HNRNPF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14268-NF
HNRNPF cDNA ORF Clone, Human, C-His tag HG14268-CH
HNRNPF cDNA ORF Clone, Human, N-His tag HG14268-NH
HNRNPF cDNA ORF Clone, Human, C-HA tag HG14268-CY
HNRNPF cDNA ORF Clone, Human, N-HA tag HG14268-NY
HNRNPF cDNA ORF Clone, Human, N-Myc tag HG14268-NM
HNRNPF qPCR Primer Pairs, Human HP102918
info info
添加购物车成功! 添加购物车失败!