HNRNPC cDNA ORF Clone, Human, C-His tag

Cat: HG14629-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HNRNPC Reagents
CRO Services
Product recommended

All HNRNPC Reagents
HNRNPC cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
882 bp
Description
Full length Clone DNA of Human heterogeneous nuclear ribonucleoprotein C (C1/C2) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPC cDNA ORF Clone, Human, C-His tag Alternative Names
C1 cDNA ORF Clone, Human;C2 cDNA ORF Clone, Human;HNRNP cDNA ORF Clone, Human;HNRPC cDNA ORF Clone, Human;SNRPC cDNA ORF Clone, Human
HNRNPC Background Information
Full Name
heterogeneous nuclear ribonucleoprotein C (C1/C2)

HNRNPC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HNRNPC cDNA ORF Clone in Cloning Vector, Rat RG80912-U
HNRNPC cDNA ORF Clone, Rat, untagged RG80912-UT
HNRNPC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80912-ACGLN
HNRNPC cDNA ORF Clone, Rat, C-GFPSpark® tag RG80912-ACG
HNRNPC cDNA ORF Clone, Rat, N-GFPSpark® tag RG80912-ANG
HNRNPC cDNA ORF Clone, Rat, C-OFPSpark® tag RG80912-ACR
HNRNPC cDNA ORF Clone, Rat, N-OFPSpark® tag RG80912-ANR
HNRNPC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80912-CF
HNRNPC cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80912-NF
HNRNPC cDNA ORF Clone, Rat, C-His tag RG80912-CH
HNRNPC cDNA ORF Clone, Rat, N-His tag RG80912-NH
HNRNPC cDNA ORF Clone, Rat, C-HA tag RG80912-CY
HNRNPC cDNA ORF Clone, Rat, N-HA tag RG80912-NY
HNRNPC cDNA ORF Clone, Rat, C-Myc tag RG80912-CM
HNRNPC cDNA ORF Clone, Rat, N-Myc tag RG80912-NM
HNRNPC qPCR Primer Pairs, Rat RP300876

HNRNPC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNRNPC cDNA ORF Clone in Cloning Vector, Mouse MG51852-G
HNRNPC cDNA ORF Clone, Mouse, untagged MG51852-UT
HNRNPC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51852-ACGLN
HNRNPC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51852-ACG
HNRNPC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51852-ACR
HNRNPC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51852-CF
HNRNPC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51852-NF
HNRNPC cDNA ORF Clone, Mouse, C-His tag MG51852-CH
HNRNPC cDNA ORF Clone, Mouse, N-His tag MG51852-NH
HNRNPC cDNA ORF Clone, Mouse, C-HA tag MG51852-CY
HNRNPC cDNA ORF Clone, Mouse, N-HA tag MG51852-NY
HNRNPC cDNA ORF Clone, Mouse, C-Myc tag MG51852-CM
HNRNPC cDNA ORF Clone, Mouse, N-Myc tag MG51852-NM
HNRNPC qPCR Primer Pairs, Mouse MP201725

HNRNPC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPC cDNA ORF Clone in Cloning Vector, Human HG14629-G
HNRNPC cDNA ORF Clone, Human, untagged HG14629-UT
HNRNPC cDNA ORF Clone, Human, C-GFPSpark® tag HG14629-ACG
HNRNPC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14629-ACGLN
HNRNPC cDNA ORF Clone, Human, N-GFPSpark® tag HG14629-ANG
HNRNPC cDNA ORF Clone, Human, C-OFPSpark® tag HG14629-ACR
HNRNPC cDNA ORF Clone, Human, N-OFPSpark® tag HG14629-ANR
HNRNPC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14629-CF
HNRNPC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14629-NF
HNRNPC cDNA ORF Clone, Human, N-His tag HG14629-NH
HNRNPC cDNA ORF Clone, Human, C-HA tag HG14629-CY
HNRNPC cDNA ORF Clone, Human, N-HA tag HG14629-NY
HNRNPC cDNA ORF Clone, Human, C-Myc tag HG14629-CM
HNRNPC cDNA ORF Clone, Human, N-Myc tag HG14629-NM
HNRNPC qPCR Primer Pairs, Human HP103263
info info
添加购物车成功! 添加购物车失败!