HMGB2 cDNA ORF Clone, Human, untagged

Cat: HG14374-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HMGB2 Reagents
CRO Services
Product recommended

All HMGB2 Reagents
HMGB2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Human high-mobility group box 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGB2 cDNA ORF Clone, Human, untagged Alternative Names
HMG2 cDNA ORF Clone, Human
HMGB2 Background Information
Full Name
high mobility group box 2

HMGB2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMGB2 cDNA ORF Clone in Cloning Vector, Mouse MG53437-U
HMGB2 cDNA ORF Clone, Mouse, untagged MG53437-UT
HMGB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53437-ACGLN
HMGB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53437-ACG
HMGB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53437-ANG
HMGB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53437-ACR
HMGB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53437-ANR
HMGB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53437-CF
HMGB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53437-NF
HMGB2 cDNA ORF Clone, Mouse, C-His tag MG53437-CH
HMGB2 cDNA ORF Clone, Mouse, N-His tag MG53437-NH
HMGB2 cDNA ORF Clone, Mouse, C-HA tag MG53437-CY
HMGB2 cDNA ORF Clone, Mouse, N-HA tag MG53437-NY
HMGB2 cDNA ORF Clone, Mouse, C-Myc tag MG53437-CM
HMGB2 cDNA ORF Clone, Mouse, N-Myc tag MG53437-NM

HMGB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMGB2 cDNA ORF Clone in Cloning Vector, Human HG14374-G
HMGB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14374-ACGLN
HMGB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14374-ACG
HMGB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14374-ANG
HMGB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14374-ACR
HMGB2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14374-ANR
HMGB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14374-CF
HMGB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14374-NF
HMGB2 cDNA ORF Clone, Human, C-His tag HG14374-CH
HMGB2 cDNA ORF Clone, Human, N-His tag HG14374-NH
HMGB2 cDNA ORF Clone, Human, C-HA tag HG14374-CY
HMGB2 cDNA ORF Clone, Human, N-HA tag HG14374-NY
HMGB2 cDNA ORF Clone, Human, C-Myc tag HG14374-CM
HMGB2 cDNA ORF Clone, Human, N-Myc tag HG14374-NM
HMGB2 qPCR Primer Pairs, Human HP103023
info info
添加购物车成功! 添加购物车失败!