HMGB1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10326-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HMGB1 Reagents
CRO Services
Product recommended

All HMGB1 Reagents
HMGB1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Human high mobility group box 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGB1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HMG-1 cDNA ORF Clone, Human;HMG1 cDNA ORF Clone, Human;HMG3 cDNA ORF Clone, Human;SBP-1 cDNA ORF Clone, Human
HMGB1 Background Information

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2 and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis is present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal "necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. In addition, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.

Full Name
high mobility group box 1
References
  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
  • HMGB1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    HMGB1 cDNA ORF Clone in Cloning Vector, Rat RG81796-U
    HMGB1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81796-ACGLN

    HMGB1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HMGB1 cDNA ORF Clone in Cloning Vector, Mouse MG50913-G
    HMGB1 cDNA ORF Clone, Mouse, untagged MG50913-UT
    HMGB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50913-ACG
    HMGB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50913-ACGLN
    HMGB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50913-ANG
    HMGB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50913-ACR
    HMGB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50913-ANR
    HMGB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50913-CF
    HMGB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50913-NF
    HMGB1 cDNA ORF Clone, Mouse, C-His tag MG50913-CH
    HMGB1 cDNA ORF Clone, Mouse, N-His tag MG50913-NH
    HMGB1 cDNA ORF Clone, Mouse, C-HA tag MG50913-CY
    HMGB1 cDNA ORF Clone, Mouse, N-HA tag MG50913-NY
    HMGB1 cDNA ORF Clone, Mouse, C-Myc tag MG50913-CM
    HMGB1 cDNA ORF Clone, Mouse, N-Myc tag MG50913-NM
    HMGB1 qPCR Primer Pairs, Mouse MP200882

    HMGB1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HMGB1 cDNA ORF Clone in Cloning Vector, Human HG10326-U
    HMGB1 cDNA ORF Clone, Human, untagged HG10326-UT
    HMGB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10326-ACG
    HMGB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10326-ACGLN
    HMGB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10326-ANG
    HMGB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10326-ACR
    HMGB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10326-ANR
    HMGB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10326-CF
    HMGB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10326-NF
    HMGB1 cDNA ORF Clone, Human, C-His tag HG10326-CH
    HMGB1 cDNA ORF Clone, Human, N-His tag HG10326-NH
    HMGB1 cDNA ORF Clone, Human, C-HA tag HG10326-CY
    HMGB1 cDNA ORF Clone, Human, N-HA tag HG10326-NY
    HMGB1 cDNA ORF Clone, Human, C-Myc tag HG10326-CM
    HMGB1 qPCR Primer Pairs, Human HP100366
    info info
    添加购物车成功! 添加购物车失败!