HMG20A cDNA ORF Clone, Human, untagged

Cat: HG14212-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HMG20A Reagents
CRO Services
Product recommended

All HMG20A Reagents
HMG20A cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Human high mobility group 20A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMG20A cDNA ORF Clone, Human, untagged Alternative Names
HMGX1 cDNA ORF Clone, Human;HMGXB1 cDNA ORF Clone, Human
HMG20A Background Information
Full Name
high mobility group 20A

HMG20A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMG20A cDNA ORF Clone in Cloning Vector, Mouse MG52441-U
HMG20A cDNA ORF Clone, Mouse, untagged MG52441-UT
HMG20A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52441-ACGLN
HMG20A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52441-ACG
HMG20A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52441-ANG
HMG20A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52441-ACR
HMG20A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52441-ANR
HMG20A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52441-CF
HMG20A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52441-NF
HMG20A cDNA ORF Clone, Mouse, C-His tag MG52441-CH
HMG20A cDNA ORF Clone, Mouse, N-His tag MG52441-NH
HMG20A cDNA ORF Clone, Mouse, C-HA tag MG52441-CY
HMG20A cDNA ORF Clone, Mouse, N-HA tag MG52441-NY
HMG20A cDNA ORF Clone, Mouse, C-Myc tag MG52441-CM
HMG20A cDNA ORF Clone, Mouse, N-Myc tag MG52441-NM
HMG20A qPCR Primer Pairs, Mouse MP202314

HMG20A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMG20A cDNA ORF Clone in Cloning Vector, Human HG14212-G
HMG20A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14212-ACGLN
HMG20A cDNA ORF Clone, Human, C-GFPSpark® tag HG14212-ACG
HMG20A cDNA ORF Clone, Human, N-GFPSpark® tag HG14212-ANG
HMG20A cDNA ORF Clone, Human, C-OFPSpark® tag HG14212-ACR
HMG20A cDNA ORF Clone, Human, N-OFPSpark® tag HG14212-ANR
HMG20A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14212-CF
HMG20A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14212-NF
HMG20A cDNA ORF Clone, Human, C-His tag HG14212-CH
HMG20A cDNA ORF Clone, Human, N-His tag HG14212-NH
HMG20A cDNA ORF Clone, Human, C-HA tag HG14212-CY
HMG20A cDNA ORF Clone, Human, N-HA tag HG14212-NY
HMG20A cDNA ORF Clone, Human, C-Myc tag HG14212-CM
HMG20A cDNA ORF Clone, Human, N-Myc tag HG14212-NM
HMG20A qPCR Primer Pairs, Human HP102862
info info
添加购物车成功! 添加购物车失败!