HLA-DMB cDNA ORF Clone, Human, N-Myc tag

Cat: HG13254-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HLA-DMB Reagents
CRO Services
Product recommended

All HLA-DMB Reagents
HLA-DMB cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Human major histocompatibility complex, class II, DM bet with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HLA-DMB cDNA ORF Clone, Human, N-Myc tag Alternative Names
D6S221E cDNA ORF Clone, Human;RING7 cDNA ORF Clone, Human
HLA-DMB Background Information
Full Name
major histocompatibility complex, class II, DM beta

HLA-DMB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HLA-DMB cDNA ORF Clone in Cloning Vector, Human HG29616-G
HLA-DMB cDNA ORF Clone in Cloning Vector, Human HG13254-G
HLA-DMB cDNA ORF Clone, Human, untagged HG13254-UT
HLA-DMB cDNA ORF Clone, Human, untagged HG29616-UT
HLA-DMB cDNA ORF Clone, Human, C-GFPSpark® tag HG13254-ACG
HLA-DMB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13254-ACGLN
HLA-DMB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29616-ACGLN
HLA-DMB cDNA ORF Clone, Human, C-GFPSpark® tag HG29616-ACG
HLA-DMB cDNA ORF Clone, Human, C-OFPSpark® tag HG29616-ACR
HLA-DMB cDNA ORF Clone, Human, C-OFPSpark® tag HG13254-ACR
HLA-DMB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13254-CF
HLA-DMB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29616-CF
HLA-DMB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13254-NF
HLA-DMB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29616-NF
HLA-DMB cDNA ORF Clone, Human, C-His tag HG13254-CH
HLA-DMB cDNA ORF Clone, Human, C-His tag HG29616-CH
HLA-DMB cDNA ORF Clone, Human, N-His tag HG13254-NH
HLA-DMB cDNA ORF Clone, Human, N-His tag HG29616-NH
HLA-DMB cDNA ORF Clone, Human, C-HA tag HG13254-CY
HLA-DMB cDNA ORF Clone, Human, C-HA tag HG29616-CY
HLA-DMB cDNA ORF Clone, Human, N-HA tag HG13254-NY
HLA-DMB cDNA ORF Clone, Human, N-HA tag HG29616-NY
HLA-DMB cDNA ORF Clone, Human, C-Myc tag HG13254-CM
HLA-DMB cDNA ORF Clone, Human, C-Myc tag HG29616-CM
HLA-DMB cDNA ORF Clone, Human, N-Myc tag HG29616-NM
HLA-DMB qPCR Primer Pairs, Human HP101963
info info
添加购物车成功! 添加购物车失败!