Histone H2B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11362-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Histone H2B Reagents
CRO Services
Product recommended

All Histone H2B Reagents
Histone H2B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
381 bp
Description
Full length Clone DNA of Human histone cluster 2, H2be with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Histone H2B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
GL105 cDNA ORF Clone, Human;H2B cDNA ORF Clone, Human;H2B.1 cDNA ORF Clone, Human;H2BFQ cDNA ORF Clone, Human;H2BGL105 cDNA ORF Clone, Human;H2BQ cDNA ORF Clone, Human;MGC119802 cDNA ORF Clone, Human;MGC119804 cDNA ORF Clone, Human;MGC129733 cDNA ORF Clone, Human;MGC129734 cDNA ORF Clone, Human
Histone H2B Background Information

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. Histone proteins exhibit two levels of diversity: 1. evolutionary diversity between species and 2. subtype diversity in a class(H1, H2A, H2B, H3 or H4) within a species. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone H2B proteins have been studied in a variety of species and is easily detecred in most species. The reversible ubiquitylation of histone H2B has long been implicated in transcriptional activation and gene silencing. Phosphorylation of H2B serine 32 occurs in normal cycling and mitogen-stimulated cells. Notably, this phosphorylation is elevated in skin cancer cell lines and tissues compared with normal counterparts. HIST2H2BE is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

Full Name
histone cluster 2, H2be
Research Areas
References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993). A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002). The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Histone H2B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Histone H2B cDNA ORF Clone in Cloning Vector, Mouse MG53022-G
    Histone H2B cDNA ORF Clone, Mouse, untagged MG53022-UT
    Histone H2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53022-ACG
    Histone H2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53022-ACGLN
    Histone H2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53022-ANG
    Histone H2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53022-ACR
    Histone H2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53022-ANR
    Histone H2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53022-CF
    Histone H2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53022-NF
    Histone H2B cDNA ORF Clone, Mouse, C-His tag MG53022-CH
    Histone H2B cDNA ORF Clone, Mouse, N-His tag MG53022-NH
    Histone H2B cDNA ORF Clone, Mouse, C-HA tag MG53022-CY
    Histone H2B cDNA ORF Clone, Mouse, N-HA tag MG53022-NY
    Histone H2B cDNA ORF Clone, Mouse, C-Myc tag MG53022-CM
    Histone H2B cDNA ORF Clone, Mouse, N-Myc tag MG53022-NM

    Histone H2B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Histone H2B cDNA ORF Clone in Cloning Vector, Human HG11362-M
    Histone H2B cDNA ORF Clone, Human, untagged HG11362-UT
    Histone H2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11362-ACGLN
    Histone H2B cDNA ORF Clone, Human, C-GFPSpark® tag HG11362-ACG
    Histone H2B cDNA ORF Clone, Human, N-GFPSpark® tag HG11362-ANG
    Histone H2B cDNA ORF Clone, Human, C-OFPSpark® tag HG11362-ACR
    Histone H2B cDNA ORF Clone, Human, N-OFPSpark® tag HG11362-ANR
    Histone H2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11362-CF
    Histone H2B cDNA ORF Clone, Human, C-His tag HG11362-CH
    Histone H2B cDNA ORF Clone, Human, N-His tag HG11362-NH
    Histone H2B cDNA ORF Clone, Human, C-HA tag HG11362-CY
    Histone H2B cDNA ORF Clone, Human, N-HA tag HG11362-NY
    Histone H2B cDNA ORF Clone, Human, C-Myc tag HG11362-CM
    Histone H2B cDNA ORF Clone, Human, N-Myc tag HG11362-NM
    Histone H2B qPCR Primer Pairs, Human HP101245
    info info
    添加购物车成功! 添加购物车失败!