HIF-1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11977-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HIF-1 alpha Reagents
CRO Services
Product recommended

All HIF-1 alpha Reagents
HIF-1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2481 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
HIF-1 alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIF-1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human HIF-1 alpha/HIF1A Gene Expression validated Image 1855
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
HIF-1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
bHLHe78 cDNA ORF Clone, Human;HIF-1A cDNA ORF Clone, Human;HIF-1alpha cDNA ORF Clone, Human;HIF1 cDNA ORF Clone, Human;HIF1-ALPHA cDNA ORF Clone, Human;MOP1 cDNA ORF Clone, Human;PASD8 cDNA ORF Clone, Human
HIF-1 alpha Background Information

HIF-1 alpha, also known as HIF1A, contains 1 basic helix-loop-helix (bHLH) domain, 1 PAC (PAS-associated C-terminal) domain and 2 PAS (PER-ARNT-SIM) domains. It is one of the two subunits of Hypoxia-inducible factor-1 (HIF1). HIF1 is a transcription factor found in mammalian cells cultured under reduced oxygen tension that plays an essential role in cellular and systemic homeostatic responses to hypoxia. HIF1 is a heterodimer composed of an alpha subunit and a beta subunit. The beta subunit has been identified as the aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-1 alpha is expressed in most tissues with highest levels in kidney and heart. It is overexpressed in the majority of common human cancers and their metastases, due to the presence of intratumoral hypoxia and as a result of mutations in genes encoding oncoproteins and tumor suppressors. HIF-1 alpha functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, it activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF1A plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. HIF-1 alpha binds to core DNA sequence 5'-[AG]CGTG-3' within the hypoxia response element (HRE) of target gene promoters. Activation requires recruitment of transcriptional coactivators such as CREBPB and EP300.

Full Name
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
References
  • Zhou Q, et al. (2011) Loss of either hypoxia inducible factor 1 or 2 promotes lung cancer cell colonization. Cell Cycle. 10(13):2233-4.
  • Krishnan J, et al. (2012) Dietary obesity-associated Hif1 alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev. 26(3):259-70.
  • Novo E, et al. (2012) The biphasic nature of hypoxia-induced directional migration of activated human hepatic stellate cells. J Pathol. 226(4):588-97.
  • Dungwa JV, et al. (2011) Overexpression of carbonic anhydrase and HIF-1 in Wilms tumours. BMC Cancer. 11:390.
  • info info
    添加购物车成功! 添加购物车失败!