Quick Order

Human B7H7 / HHLA2 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
DatasheetReviewsRelated ProductsProtocols
Human HHLA2 cDNA Clone Product Information
NCBI RefSeq:BC035971.1
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Homo sapiens HERV-H LTR-associating 2.
Gene Synonym:B7H7
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HHLA2
Restriction Site:KpnI + XbaI(6.1kb+1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

B7H7 gene encodes a protein ligand found on the surface of monocytes. The encoded protein is thought to regulate cell-mediated immunity by binding to a receptor on T lymphocytes and inhibiting the proliferation of these cells. Alternate splicing results in multiple transcript variants.
HERV–H LTR-associating 2 (HHLA2, also called B7H7/B7-H5/B7y)has been recently discovered as the newest member of the B7 family and has 23–33% similarity in amino acid sequence with the other B7 molecules. This ligand is the only B7 family member that is found in humans but not in mice. It is constitutively expressed on the surface of human monocytes and is induced on B cells. HHLA2 binds to its putative receptor(s) on a variety of immune cells including CD4 and CD8 T cells and antigen-presenting cells. Similarly to B7-H3, both a T cell coinhibitory role as well as a costimulatory role has been reported for this ligand.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Janakiram M, Chinai JM, Fineberg S, et al. Expression, clinical significance, and receptor identification of the newest B7 family member HHLA2 protein. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(10):2359-2366.
  • Size / Price
    Catalog: HG16139-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"